Incidental Mutation 'R5713:Mtpap'
ID451022
Institutional Source Beutler Lab
Gene Symbol Mtpap
Ensembl Gene ENSMUSG00000024234
Gene Namemitochondrial poly(A) polymerase
SynonymsPapd1, 0610027A18Rik
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location4375592-4397330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4396280 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 524 (S524N)
Ref Sequence ENSEMBL: ENSMUSP00000025077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025077]
Predicted Effect probably benign
Transcript: ENSMUST00000025077
AA Change: S524N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000025077
Gene: ENSMUSG00000024234
AA Change: S524N

DomainStartEndE-ValueType
PDB:3PQ1|B 44 528 N/A PDB
SCOP:d1f5aa2 187 523 1e-35 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the DNA polymerase type-B-like family. This enzyme synthesizes the 3' poly(A) tail of mitochondrial transcripts and plays a role in replication-dependent histone mRNA degradation.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Mtpap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Mtpap APN 18 4379670 missense probably damaging 0.99
IGL00848:Mtpap APN 18 4380717 missense probably benign 0.00
IGL02659:Mtpap APN 18 4380703 nonsense probably null
IGL02828:Mtpap APN 18 4386207 missense probably damaging 0.99
IGL03006:Mtpap APN 18 4375721 missense possibly damaging 0.49
R0031:Mtpap UTSW 18 4383244 missense probably damaging 0.96
R0350:Mtpap UTSW 18 4396195 missense possibly damaging 0.91
R3787:Mtpap UTSW 18 4380670 missense probably damaging 1.00
R4381:Mtpap UTSW 18 4383223 missense probably benign 0.04
R4698:Mtpap UTSW 18 4375724 missense possibly damaging 0.59
R4717:Mtpap UTSW 18 4396394 missense possibly damaging 0.82
R4850:Mtpap UTSW 18 4387044 missense probably damaging 1.00
R4963:Mtpap UTSW 18 4375638 missense probably benign 0.05
R4982:Mtpap UTSW 18 4396332 missense probably benign 0.01
R5059:Mtpap UTSW 18 4375827 intron probably benign
R5311:Mtpap UTSW 18 4386328 missense probably damaging 1.00
R5600:Mtpap UTSW 18 4379674 missense probably damaging 1.00
R6312:Mtpap UTSW 18 4396175 missense possibly damaging 0.89
R7006:Mtpap UTSW 18 4380873 missense possibly damaging 0.63
R7059:Mtpap UTSW 18 4396202 missense probably damaging 1.00
R7117:Mtpap UTSW 18 4380889 critical splice donor site probably null
X0025:Mtpap UTSW 18 4375710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCTGGCAGCTAAGTACTTAC -3'
(R):5'- GCTGCATCATGCCTGTGTAC -3'

Sequencing Primer
(F):5'- CCTGGCAGCTAAGTACTTACATATG -3'
(R):5'- GCATCATGCCTGTGTACTAATTG -3'
Posted On2017-01-03