Incidental Mutation 'R5714:Kcnh8'
ID451073
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
MMRRC Submission 043186-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R5714 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52978122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1040 (V1040A)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably benign
Transcript: ENSMUST00000039366
AA Change: V1040A

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: V1040A

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184279
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,240,516 Q717* probably null Het
Alpk2 G T 18: 65,305,461 Q1421K possibly damaging Het
Ankub1 G A 3: 57,672,837 T133M probably benign Het
Bcar3 G A 3: 122,455,087 V112M possibly damaging Het
Cacna1s A G 1: 136,112,066 K1476R probably benign Het
Cdc42ep1 C A 15: 78,849,777 A359E possibly damaging Het
Cemip T A 7: 83,975,179 D483V probably damaging Het
Cyp4f39 G A 17: 32,481,825 R156H probably damaging Het
Dpys T A 15: 39,857,157 H69L probably damaging Het
Fbxl21 A G 13: 56,527,072 I79V probably benign Het
Fgf9 T C 14: 58,109,565 L205P probably damaging Het
Fkbp14 A G 6: 54,585,850 F144L probably damaging Het
Flnb A C 14: 7,929,073 D1934A probably damaging Het
Glul T C 1: 153,906,497 probably benign Het
Helz T A 11: 107,626,521 probably null Het
Kap A G 6: 133,851,993 Y42H probably benign Het
Kptn A G 7: 16,120,758 probably null Het
Lypd3 A G 7: 24,639,069 T182A possibly damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mios T A 6: 8,215,434 I210K probably damaging Het
Nat8f2 A G 6: 85,867,909 V157A probably benign Het
Olfr1 T A 11: 73,395,361 probably null Het
Pard3b C A 1: 62,637,916 A1140E probably null Het
Pcnt A T 10: 76,420,491 D638E probably damaging Het
Pdgfra T C 5: 75,186,012 I834T probably damaging Het
Phyhd1 T A 2: 30,279,982 L162H probably damaging Het
Polg C A 7: 79,451,991 A1026S possibly damaging Het
Prl7c1 A T 13: 27,778,966 L18* probably null Het
Rars2 T A 4: 34,645,779 M232K probably benign Het
Rtl1 A G 12: 109,593,680 V575A probably damaging Het
Slc18b1 A T 10: 23,798,766 T40S probably benign Het
Slc22a19 T C 19: 7,711,022 T58A probably damaging Het
Slc27a6 A T 18: 58,598,553 E325V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srd5a3 T A 5: 76,153,566 F214Y probably benign Het
Tgfbr2 A T 9: 116,175,024 L5Q probably damaging Het
Tmem94 C A 11: 115,793,190 Q779K probably benign Het
Ttn G A 2: 76,822,493 P216S probably benign Het
Ush2a A T 1: 188,400,257 Q892L probably benign Het
Vgll4 A T 6: 114,890,776 M38K possibly damaging Het
Vmn2r109 A G 17: 20,552,859 I500T probably damaging Het
Vps33a T C 5: 123,569,500 I135V probably benign Het
Wscd1 T C 11: 71,784,435 probably null Het
Zfp457 C A 13: 67,296,426 M4I possibly damaging Het
Zfp532 G A 18: 65,623,535 G180R possibly damaging Het
Zfp97 A G 17: 17,145,609 T457A possibly damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCAGACAGTGAACTTCATC -3'
(R):5'- TCGAAAACGGCCCTTGTGTG -3'

Sequencing Primer
(F):5'- GCAGACAGTGAACTTCATCATTCTC -3'
(R):5'- CGGCCCTTGTGTGCTGATATTATAC -3'
Posted On2017-01-03