Incidental Mutation 'R5715:Mab21l3'
ID451091
Institutional Source Beutler Lab
Gene Symbol Mab21l3
Ensembl Gene ENSMUSG00000044313
Gene Namemab-21-like 3 (C. elegans)
SynonymsBC037703
MMRRC Submission 043336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5715 (G1)
Quality Score211
Status Not validated
Chromosome3
Chromosomal Location101813076-101848959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101823407 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 172 (R172Q)
Ref Sequence ENSEMBL: ENSMUSP00000112730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061831] [ENSMUST00000118411]
Predicted Effect probably benign
Transcript: ENSMUST00000061831
AA Change: R172Q

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059212
Gene: ENSMUSG00000044313
AA Change: R172Q

DomainStartEndE-ValueType
Mab-21 124 422 3.17e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118411
AA Change: R172Q

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112730
Gene: ENSMUSG00000044313
AA Change: R172Q

DomainStartEndE-ValueType
Mab-21 124 422 3.17e-104 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,207,977 Y56H possibly damaging Het
9930111J21Rik2 T A 11: 49,019,950 Y552F probably damaging Het
Asprv1 T A 6: 86,628,614 D147E probably benign Het
Atg4c G T 4: 99,258,402 L405F probably damaging Het
Birc6 C T 17: 74,631,620 L2670F probably damaging Het
Cdc20 T C 4: 118,434,818 D379G probably damaging Het
Chd6 T C 2: 160,949,878 M2520V probably benign Het
Clca4b A G 3: 144,913,257 V707A probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col12a1 A T 9: 79,616,065 C2743* probably null Het
Coq6 C A 12: 84,366,907 D70E probably benign Het
Cspg4 T A 9: 56,891,051 V1450D possibly damaging Het
Dnah7a A G 1: 53,413,778 L3847P probably damaging Het
Drd2 T A 9: 49,404,889 H316Q probably benign Het
Dusp19 T A 2: 80,630,986 N206K probably benign Het
Fam13c T G 10: 70,534,840 F270C probably damaging Het
Fam20a T C 11: 109,678,431 E246G probably damaging Het
Fbxo31 A G 8: 121,578,563 F65L probably damaging Het
Fshr T A 17: 88,986,396 probably null Het
Fstl4 T C 11: 53,000,416 V127A possibly damaging Het
Gdpd4 A T 7: 97,961,597 I75F probably benign Het
Gm13128 A G 4: 144,331,300 D159G possibly damaging Het
Grm5 C A 7: 88,130,256 A968E probably benign Het
Gucy2g A C 19: 55,233,155 F305V possibly damaging Het
Hivep3 T C 4: 120,096,373 F629L probably benign Het
Hoxb1 A G 11: 96,366,326 E167G probably benign Het
Hoxd4 T C 2: 74,727,364 L29P probably damaging Het
Ikbkb A G 8: 22,678,850 L211P probably damaging Het
Insc T C 7: 114,849,841 V499A probably benign Het
Irak3 A T 10: 120,142,736 H511Q possibly damaging Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Lurap1l T A 4: 80,953,721 S150R possibly damaging Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Mettl21a A T 1: 64,615,155 S68T probably benign Het
Mlxip T A 5: 123,440,058 W146R probably damaging Het
Mpp2 T A 11: 102,062,261 N285I probably damaging Het
Mrgprb4 T C 7: 48,199,039 N47S probably damaging Het
Msi2 A G 11: 88,386,063 Y237H probably damaging Het
Muc4 C T 16: 32,751,916 T598I possibly damaging Het
Musk A T 4: 58,333,663 I253F probably damaging Het
Myo5b G T 18: 74,742,175 C1550F possibly damaging Het
Nckap5l T C 15: 99,423,576 T1137A probably benign Het
Neb T C 2: 52,251,768 D3009G probably damaging Het
Nxph1 T A 6: 9,247,740 V237E probably damaging Het
Olfr622 A C 7: 103,639,802 S113A probably damaging Het
Pla2g12a A G 3: 129,894,942 K150E probably damaging Het
Ptpn23 G A 9: 110,387,075 R1238W probably damaging Het
Pts C T 9: 50,522,278 G124R probably damaging Het
Rfk A T 19: 17,398,638 I99F probably benign Het
Rictor A T 15: 6,750,716 R151* probably null Het
Scn2a T A 2: 65,717,584 I1040N probably benign Het
Serinc5 A C 13: 92,706,202 T387P probably damaging Het
Sh3bp5l A G 11: 58,346,015 Q266R possibly damaging Het
Slc14a2 T C 18: 78,158,336 Y656C probably damaging Het
Slc26a3 T A 12: 31,448,843 probably null Het
Slc3a2 G T 19: 8,708,230 H168Q probably benign Het
Smarca2 A T 19: 26,649,122 I449L probably benign Het
Smarcc1 T C 9: 110,196,367 V704A possibly damaging Het
Sox13 A G 1: 133,386,183 probably null Het
Sptbn5 T C 2: 120,072,504 E7G probably damaging Het
Stard10 A G 7: 101,321,903 D26G probably damaging Het
Tap1 A T 17: 34,192,894 R91* probably null Het
Tgfbrap1 A T 1: 43,059,937 V239D possibly damaging Het
Tmem209 A T 6: 30,497,923 Y124* probably null Het
Tmprss2 T A 16: 97,568,983 E327V possibly damaging Het
Ttbk1 T C 17: 46,479,207 Y104C probably damaging Het
Ttll10 A T 4: 156,045,391 F154I probably damaging Het
Ubn2 T A 6: 38,461,477 Y40* probably null Het
Ubr5 A T 15: 38,002,233 S1519T probably benign Het
Ugt3a1 A C 15: 9,306,344 D193A probably damaging Het
Upf1 A T 8: 70,352,978 Y6N probably damaging Het
Vmn2r103 A T 17: 19,794,939 D447V probably benign Het
Vps39 T C 2: 120,325,236 N519S possibly damaging Het
Zfp109 T C 7: 24,229,570 E138G possibly damaging Het
Znrf3 A C 11: 5,286,239 V157G possibly damaging Het
Other mutations in Mab21l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mab21l3 APN 3 101823455 missense probably damaging 0.99
IGL01123:Mab21l3 APN 3 101835130 missense probably benign 0.06
IGL01997:Mab21l3 APN 3 101818639 missense probably damaging 0.99
IGL02423:Mab21l3 APN 3 101818729 missense probably damaging 1.00
IGL02546:Mab21l3 APN 3 101823308 missense probably damaging 1.00
R1268:Mab21l3 UTSW 3 101835047 missense possibly damaging 0.88
R1803:Mab21l3 UTSW 3 101835130 missense probably benign 0.06
R2056:Mab21l3 UTSW 3 101815153 missense possibly damaging 0.55
R2104:Mab21l3 UTSW 3 101823428 missense probably benign 0.31
R3107:Mab21l3 UTSW 3 101826796 missense probably damaging 1.00
R3405:Mab21l3 UTSW 3 101823531 missense probably damaging 1.00
R3406:Mab21l3 UTSW 3 101823531 missense probably damaging 1.00
R6612:Mab21l3 UTSW 3 101818645 missense possibly damaging 0.55
R7183:Mab21l3 UTSW 3 101815153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGACTGGTTATCACTCCCC -3'
(R):5'- TTGCTTGAGCTGCCTGACTG -3'

Sequencing Primer
(F):5'- TGACCTCACCGGCTCAC -3'
(R):5'- TTGAGCTGCCTGACTGGACAG -3'
Posted On2017-01-03