Incidental Mutation 'R5715:Coq6'
ID451135
Institutional Source Beutler Lab
Gene Symbol Coq6
Ensembl Gene ENSMUSG00000021235
Gene Namecoenzyme Q6 monooxygenase
Synonyms5930427M12Rik
MMRRC Submission 043336-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5715 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84361657-84373796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84366907 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 70 (D70E)
Ref Sequence ENSEMBL: ENSMUSP00000115676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021661] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000152913]
Predicted Effect probably benign
Transcript: ENSMUST00000021661
AA Change: D70E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235
AA Change: D70E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110276
AA Change: D70E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235
AA Change: D70E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110278
AA Change: D70E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235
AA Change: D70E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140961
Predicted Effect unknown
Transcript: ENSMUST00000145522
AA Change: D65E
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235
AA Change: D65E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150391
Predicted Effect probably benign
Transcript: ENSMUST00000152913
AA Change: D70E

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235
AA Change: D70E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156592
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,207,977 Y56H possibly damaging Het
9930111J21Rik2 T A 11: 49,019,950 Y552F probably damaging Het
Asprv1 T A 6: 86,628,614 D147E probably benign Het
Atg4c G T 4: 99,258,402 L405F probably damaging Het
Birc6 C T 17: 74,631,620 L2670F probably damaging Het
Cdc20 T C 4: 118,434,818 D379G probably damaging Het
Chd6 T C 2: 160,949,878 M2520V probably benign Het
Clca4b A G 3: 144,913,257 V707A probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col12a1 A T 9: 79,616,065 C2743* probably null Het
Cspg4 T A 9: 56,891,051 V1450D possibly damaging Het
Dnah7a A G 1: 53,413,778 L3847P probably damaging Het
Drd2 T A 9: 49,404,889 H316Q probably benign Het
Dusp19 T A 2: 80,630,986 N206K probably benign Het
Fam13c T G 10: 70,534,840 F270C probably damaging Het
Fam20a T C 11: 109,678,431 E246G probably damaging Het
Fbxo31 A G 8: 121,578,563 F65L probably damaging Het
Fshr T A 17: 88,986,396 probably null Het
Fstl4 T C 11: 53,000,416 V127A possibly damaging Het
Gdpd4 A T 7: 97,961,597 I75F probably benign Het
Gm13128 A G 4: 144,331,300 D159G possibly damaging Het
Grm5 C A 7: 88,130,256 A968E probably benign Het
Gucy2g A C 19: 55,233,155 F305V possibly damaging Het
Hivep3 T C 4: 120,096,373 F629L probably benign Het
Hoxb1 A G 11: 96,366,326 E167G probably benign Het
Hoxd4 T C 2: 74,727,364 L29P probably damaging Het
Ikbkb A G 8: 22,678,850 L211P probably damaging Het
Insc T C 7: 114,849,841 V499A probably benign Het
Irak3 A T 10: 120,142,736 H511Q possibly damaging Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Lurap1l T A 4: 80,953,721 S150R possibly damaging Het
Mab21l3 C T 3: 101,823,407 R172Q probably benign Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Mettl21a A T 1: 64,615,155 S68T probably benign Het
Mlxip T A 5: 123,440,058 W146R probably damaging Het
Mpp2 T A 11: 102,062,261 N285I probably damaging Het
Mrgprb4 T C 7: 48,199,039 N47S probably damaging Het
Msi2 A G 11: 88,386,063 Y237H probably damaging Het
Muc4 C T 16: 32,751,916 T598I possibly damaging Het
Musk A T 4: 58,333,663 I253F probably damaging Het
Myo5b G T 18: 74,742,175 C1550F possibly damaging Het
Nckap5l T C 15: 99,423,576 T1137A probably benign Het
Neb T C 2: 52,251,768 D3009G probably damaging Het
Nxph1 T A 6: 9,247,740 V237E probably damaging Het
Olfr622 A C 7: 103,639,802 S113A probably damaging Het
Pla2g12a A G 3: 129,894,942 K150E probably damaging Het
Ptpn23 G A 9: 110,387,075 R1238W probably damaging Het
Pts C T 9: 50,522,278 G124R probably damaging Het
Rfk A T 19: 17,398,638 I99F probably benign Het
Rictor A T 15: 6,750,716 R151* probably null Het
Scn2a T A 2: 65,717,584 I1040N probably benign Het
Serinc5 A C 13: 92,706,202 T387P probably damaging Het
Sh3bp5l A G 11: 58,346,015 Q266R possibly damaging Het
Slc14a2 T C 18: 78,158,336 Y656C probably damaging Het
Slc26a3 T A 12: 31,448,843 probably null Het
Slc3a2 G T 19: 8,708,230 H168Q probably benign Het
Smarca2 A T 19: 26,649,122 I449L probably benign Het
Smarcc1 T C 9: 110,196,367 V704A possibly damaging Het
Sox13 A G 1: 133,386,183 probably null Het
Sptbn5 T C 2: 120,072,504 E7G probably damaging Het
Stard10 A G 7: 101,321,903 D26G probably damaging Het
Tap1 A T 17: 34,192,894 R91* probably null Het
Tgfbrap1 A T 1: 43,059,937 V239D possibly damaging Het
Tmem209 A T 6: 30,497,923 Y124* probably null Het
Tmprss2 T A 16: 97,568,983 E327V possibly damaging Het
Ttbk1 T C 17: 46,479,207 Y104C probably damaging Het
Ttll10 A T 4: 156,045,391 F154I probably damaging Het
Ubn2 T A 6: 38,461,477 Y40* probably null Het
Ubr5 A T 15: 38,002,233 S1519T probably benign Het
Ugt3a1 A C 15: 9,306,344 D193A probably damaging Het
Upf1 A T 8: 70,352,978 Y6N probably damaging Het
Vmn2r103 A T 17: 19,794,939 D447V probably benign Het
Vps39 T C 2: 120,325,236 N519S possibly damaging Het
Zfp109 T C 7: 24,229,570 E138G possibly damaging Het
Znrf3 A C 11: 5,286,239 V157G possibly damaging Het
Other mutations in Coq6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0508:Coq6 UTSW 12 84368139 splice site probably benign
R0607:Coq6 UTSW 12 84368638 missense possibly damaging 0.95
R1221:Coq6 UTSW 12 84371527 missense possibly damaging 0.96
R1885:Coq6 UTSW 12 84372464 missense probably damaging 1.00
R1898:Coq6 UTSW 12 84366963 missense probably benign 0.38
R3153:Coq6 UTSW 12 84371535 missense probably damaging 1.00
R3824:Coq6 UTSW 12 84372415 splice site probably benign
R4015:Coq6 UTSW 12 84366897 missense probably benign 0.00
R4241:Coq6 UTSW 12 84373789 utr 3 prime probably benign
R4285:Coq6 UTSW 12 84370404 intron probably benign
R4353:Coq6 UTSW 12 84368149 missense probably damaging 0.99
R4598:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4599:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4868:Coq6 UTSW 12 84370952 missense probably damaging 0.99
R4887:Coq6 UTSW 12 84372296 missense probably damaging 1.00
R5567:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5570:Coq6 UTSW 12 84368639 missense probably benign 0.10
R6608:Coq6 UTSW 12 84372148 missense probably benign 0.00
R7035:Coq6 UTSW 12 84368641 missense probably damaging 0.99
R7096:Coq6 UTSW 12 84361821 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACCCCTGGAGCTGGTTTATATTTG -3'
(R):5'- CCTACTGAACTGGAAAGCGG -3'

Sequencing Primer
(F):5'- CTGGAGCTGGTTTATATTTGTTTCTG -3'
(R):5'- TACTGAACTGGAAAGCGGAGGAAAG -3'
Posted On2017-01-03