Incidental Mutation 'R5715:Ubr5'
ID451139
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 043336-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5715 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38002233 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1519 (S1519T)
Ref Sequence ENSEMBL: ENSMUSP00000105965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably benign
Transcript: ENSMUST00000110336
AA Change: S1519T

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: S1519T

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226137
Predicted Effect probably benign
Transcript: ENSMUST00000226414
AA Change: S1525T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228504
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,207,977 Y56H possibly damaging Het
9930111J21Rik2 T A 11: 49,019,950 Y552F probably damaging Het
Asprv1 T A 6: 86,628,614 D147E probably benign Het
Atg4c G T 4: 99,258,402 L405F probably damaging Het
Birc6 C T 17: 74,631,620 L2670F probably damaging Het
Cdc20 T C 4: 118,434,818 D379G probably damaging Het
Chd6 T C 2: 160,949,878 M2520V probably benign Het
Clca4b A G 3: 144,913,257 V707A probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col12a1 A T 9: 79,616,065 C2743* probably null Het
Coq6 C A 12: 84,366,907 D70E probably benign Het
Cspg4 T A 9: 56,891,051 V1450D possibly damaging Het
Dnah7a A G 1: 53,413,778 L3847P probably damaging Het
Drd2 T A 9: 49,404,889 H316Q probably benign Het
Dusp19 T A 2: 80,630,986 N206K probably benign Het
Fam13c T G 10: 70,534,840 F270C probably damaging Het
Fam20a T C 11: 109,678,431 E246G probably damaging Het
Fbxo31 A G 8: 121,578,563 F65L probably damaging Het
Fshr T A 17: 88,986,396 probably null Het
Fstl4 T C 11: 53,000,416 V127A possibly damaging Het
Gdpd4 A T 7: 97,961,597 I75F probably benign Het
Gm13128 A G 4: 144,331,300 D159G possibly damaging Het
Grm5 C A 7: 88,130,256 A968E probably benign Het
Gucy2g A C 19: 55,233,155 F305V possibly damaging Het
Hivep3 T C 4: 120,096,373 F629L probably benign Het
Hoxb1 A G 11: 96,366,326 E167G probably benign Het
Hoxd4 T C 2: 74,727,364 L29P probably damaging Het
Ikbkb A G 8: 22,678,850 L211P probably damaging Het
Insc T C 7: 114,849,841 V499A probably benign Het
Irak3 A T 10: 120,142,736 H511Q possibly damaging Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Lurap1l T A 4: 80,953,721 S150R possibly damaging Het
Mab21l3 C T 3: 101,823,407 R172Q probably benign Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Mettl21a A T 1: 64,615,155 S68T probably benign Het
Mlxip T A 5: 123,440,058 W146R probably damaging Het
Mpp2 T A 11: 102,062,261 N285I probably damaging Het
Mrgprb4 T C 7: 48,199,039 N47S probably damaging Het
Msi2 A G 11: 88,386,063 Y237H probably damaging Het
Muc4 C T 16: 32,751,916 T598I possibly damaging Het
Musk A T 4: 58,333,663 I253F probably damaging Het
Myo5b G T 18: 74,742,175 C1550F possibly damaging Het
Nckap5l T C 15: 99,423,576 T1137A probably benign Het
Neb T C 2: 52,251,768 D3009G probably damaging Het
Nxph1 T A 6: 9,247,740 V237E probably damaging Het
Olfr622 A C 7: 103,639,802 S113A probably damaging Het
Pla2g12a A G 3: 129,894,942 K150E probably damaging Het
Ptpn23 G A 9: 110,387,075 R1238W probably damaging Het
Pts C T 9: 50,522,278 G124R probably damaging Het
Rfk A T 19: 17,398,638 I99F probably benign Het
Rictor A T 15: 6,750,716 R151* probably null Het
Scn2a T A 2: 65,717,584 I1040N probably benign Het
Serinc5 A C 13: 92,706,202 T387P probably damaging Het
Sh3bp5l A G 11: 58,346,015 Q266R possibly damaging Het
Slc14a2 T C 18: 78,158,336 Y656C probably damaging Het
Slc26a3 T A 12: 31,448,843 probably null Het
Slc3a2 G T 19: 8,708,230 H168Q probably benign Het
Smarca2 A T 19: 26,649,122 I449L probably benign Het
Smarcc1 T C 9: 110,196,367 V704A possibly damaging Het
Sox13 A G 1: 133,386,183 probably null Het
Sptbn5 T C 2: 120,072,504 E7G probably damaging Het
Stard10 A G 7: 101,321,903 D26G probably damaging Het
Tap1 A T 17: 34,192,894 R91* probably null Het
Tgfbrap1 A T 1: 43,059,937 V239D possibly damaging Het
Tmem209 A T 6: 30,497,923 Y124* probably null Het
Tmprss2 T A 16: 97,568,983 E327V possibly damaging Het
Ttbk1 T C 17: 46,479,207 Y104C probably damaging Het
Ttll10 A T 4: 156,045,391 F154I probably damaging Het
Ubn2 T A 6: 38,461,477 Y40* probably null Het
Ugt3a1 A C 15: 9,306,344 D193A probably damaging Het
Upf1 A T 8: 70,352,978 Y6N probably damaging Het
Vmn2r103 A T 17: 19,794,939 D447V probably benign Het
Vps39 T C 2: 120,325,236 N519S possibly damaging Het
Zfp109 T C 7: 24,229,570 E138G possibly damaging Het
Znrf3 A C 11: 5,286,239 V157G possibly damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense not run
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGTAGAGAGGTGTTCCAATTCC -3'
(R):5'- CACTGCTTCCTTATGCTGTAGAAG -3'

Sequencing Primer
(F):5'- TAGAGAGGTGTTCCAATTCCAAAAG -3'
(R):5'- GCTTCCTTATGCTGTAGAAGAATTG -3'
Posted On2017-01-03