Incidental Mutation 'R5715:Myo5b'
ID451148
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
MMRRC Submission 043336-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R5715 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74742175 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1550 (C1550F)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074157
AA Change: C1524F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: C1524F

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121875
AA Change: C1550F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: C1550F

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154986
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,207,977 Y56H possibly damaging Het
9930111J21Rik2 T A 11: 49,019,950 Y552F probably damaging Het
Asprv1 T A 6: 86,628,614 D147E probably benign Het
Atg4c G T 4: 99,258,402 L405F probably damaging Het
Birc6 C T 17: 74,631,620 L2670F probably damaging Het
Cdc20 T C 4: 118,434,818 D379G probably damaging Het
Chd6 T C 2: 160,949,878 M2520V probably benign Het
Clca4b A G 3: 144,913,257 V707A probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col12a1 A T 9: 79,616,065 C2743* probably null Het
Coq6 C A 12: 84,366,907 D70E probably benign Het
Cspg4 T A 9: 56,891,051 V1450D possibly damaging Het
Dnah7a A G 1: 53,413,778 L3847P probably damaging Het
Drd2 T A 9: 49,404,889 H316Q probably benign Het
Dusp19 T A 2: 80,630,986 N206K probably benign Het
Fam13c T G 10: 70,534,840 F270C probably damaging Het
Fam20a T C 11: 109,678,431 E246G probably damaging Het
Fbxo31 A G 8: 121,578,563 F65L probably damaging Het
Fshr T A 17: 88,986,396 probably null Het
Fstl4 T C 11: 53,000,416 V127A possibly damaging Het
Gdpd4 A T 7: 97,961,597 I75F probably benign Het
Gm13128 A G 4: 144,331,300 D159G possibly damaging Het
Grm5 C A 7: 88,130,256 A968E probably benign Het
Gucy2g A C 19: 55,233,155 F305V possibly damaging Het
Hivep3 T C 4: 120,096,373 F629L probably benign Het
Hoxb1 A G 11: 96,366,326 E167G probably benign Het
Hoxd4 T C 2: 74,727,364 L29P probably damaging Het
Ikbkb A G 8: 22,678,850 L211P probably damaging Het
Insc T C 7: 114,849,841 V499A probably benign Het
Irak3 A T 10: 120,142,736 H511Q possibly damaging Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Lurap1l T A 4: 80,953,721 S150R possibly damaging Het
Mab21l3 C T 3: 101,823,407 R172Q probably benign Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Mettl21a A T 1: 64,615,155 S68T probably benign Het
Mlxip T A 5: 123,440,058 W146R probably damaging Het
Mpp2 T A 11: 102,062,261 N285I probably damaging Het
Mrgprb4 T C 7: 48,199,039 N47S probably damaging Het
Msi2 A G 11: 88,386,063 Y237H probably damaging Het
Muc4 C T 16: 32,751,916 T598I possibly damaging Het
Musk A T 4: 58,333,663 I253F probably damaging Het
Nckap5l T C 15: 99,423,576 T1137A probably benign Het
Neb T C 2: 52,251,768 D3009G probably damaging Het
Nxph1 T A 6: 9,247,740 V237E probably damaging Het
Olfr622 A C 7: 103,639,802 S113A probably damaging Het
Pla2g12a A G 3: 129,894,942 K150E probably damaging Het
Ptpn23 G A 9: 110,387,075 R1238W probably damaging Het
Pts C T 9: 50,522,278 G124R probably damaging Het
Rfk A T 19: 17,398,638 I99F probably benign Het
Rictor A T 15: 6,750,716 R151* probably null Het
Scn2a T A 2: 65,717,584 I1040N probably benign Het
Serinc5 A C 13: 92,706,202 T387P probably damaging Het
Sh3bp5l A G 11: 58,346,015 Q266R possibly damaging Het
Slc14a2 T C 18: 78,158,336 Y656C probably damaging Het
Slc26a3 T A 12: 31,448,843 probably null Het
Slc3a2 G T 19: 8,708,230 H168Q probably benign Het
Smarca2 A T 19: 26,649,122 I449L probably benign Het
Smarcc1 T C 9: 110,196,367 V704A possibly damaging Het
Sox13 A G 1: 133,386,183 probably null Het
Sptbn5 T C 2: 120,072,504 E7G probably damaging Het
Stard10 A G 7: 101,321,903 D26G probably damaging Het
Tap1 A T 17: 34,192,894 R91* probably null Het
Tgfbrap1 A T 1: 43,059,937 V239D possibly damaging Het
Tmem209 A T 6: 30,497,923 Y124* probably null Het
Tmprss2 T A 16: 97,568,983 E327V possibly damaging Het
Ttbk1 T C 17: 46,479,207 Y104C probably damaging Het
Ttll10 A T 4: 156,045,391 F154I probably damaging Het
Ubn2 T A 6: 38,461,477 Y40* probably null Het
Ubr5 A T 15: 38,002,233 S1519T probably benign Het
Ugt3a1 A C 15: 9,306,344 D193A probably damaging Het
Upf1 A T 8: 70,352,978 Y6N probably damaging Het
Vmn2r103 A T 17: 19,794,939 D447V probably benign Het
Vps39 T C 2: 120,325,236 N519S possibly damaging Het
Zfp109 T C 7: 24,229,570 E138G possibly damaging Het
Znrf3 A C 11: 5,286,239 V157G possibly damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CAAAGATTAGCTCTGCTGGGAC -3'
(R):5'- CCCAGTCTTGCAAAGAAAGGC -3'

Sequencing Primer
(F):5'- TCTGCTGGGACTGGAAAGC -3'
(R):5'- AGGCATTCCCACAATCTGAGGTTC -3'
Posted On2017-01-03