Incidental Mutation 'R5715:Slc14a2'
ID451149
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Namesolute carrier family 14 (urea transporter), member 2
SynonymsUT-A5, UT-A3
MMRRC Submission 043336-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5715 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location78146940-78209094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78158336 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 656 (Y656C)
Ref Sequence ENSEMBL: ENSMUSP00000025434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434]
Predicted Effect probably damaging
Transcript: ENSMUST00000025434
AA Change: Y656C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: Y656C

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,207,977 Y56H possibly damaging Het
9930111J21Rik2 T A 11: 49,019,950 Y552F probably damaging Het
Asprv1 T A 6: 86,628,614 D147E probably benign Het
Atg4c G T 4: 99,258,402 L405F probably damaging Het
Birc6 C T 17: 74,631,620 L2670F probably damaging Het
Cdc20 T C 4: 118,434,818 D379G probably damaging Het
Chd6 T C 2: 160,949,878 M2520V probably benign Het
Clca4b A G 3: 144,913,257 V707A probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col12a1 A T 9: 79,616,065 C2743* probably null Het
Coq6 C A 12: 84,366,907 D70E probably benign Het
Cspg4 T A 9: 56,891,051 V1450D possibly damaging Het
Dnah7a A G 1: 53,413,778 L3847P probably damaging Het
Drd2 T A 9: 49,404,889 H316Q probably benign Het
Dusp19 T A 2: 80,630,986 N206K probably benign Het
Fam13c T G 10: 70,534,840 F270C probably damaging Het
Fam20a T C 11: 109,678,431 E246G probably damaging Het
Fbxo31 A G 8: 121,578,563 F65L probably damaging Het
Fshr T A 17: 88,986,396 probably null Het
Fstl4 T C 11: 53,000,416 V127A possibly damaging Het
Gdpd4 A T 7: 97,961,597 I75F probably benign Het
Gm13128 A G 4: 144,331,300 D159G possibly damaging Het
Grm5 C A 7: 88,130,256 A968E probably benign Het
Gucy2g A C 19: 55,233,155 F305V possibly damaging Het
Hivep3 T C 4: 120,096,373 F629L probably benign Het
Hoxb1 A G 11: 96,366,326 E167G probably benign Het
Hoxd4 T C 2: 74,727,364 L29P probably damaging Het
Ikbkb A G 8: 22,678,850 L211P probably damaging Het
Insc T C 7: 114,849,841 V499A probably benign Het
Irak3 A T 10: 120,142,736 H511Q possibly damaging Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Lurap1l T A 4: 80,953,721 S150R possibly damaging Het
Mab21l3 C T 3: 101,823,407 R172Q probably benign Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Mettl21a A T 1: 64,615,155 S68T probably benign Het
Mlxip T A 5: 123,440,058 W146R probably damaging Het
Mpp2 T A 11: 102,062,261 N285I probably damaging Het
Mrgprb4 T C 7: 48,199,039 N47S probably damaging Het
Msi2 A G 11: 88,386,063 Y237H probably damaging Het
Muc4 C T 16: 32,751,916 T598I possibly damaging Het
Musk A T 4: 58,333,663 I253F probably damaging Het
Myo5b G T 18: 74,742,175 C1550F possibly damaging Het
Nckap5l T C 15: 99,423,576 T1137A probably benign Het
Neb T C 2: 52,251,768 D3009G probably damaging Het
Nxph1 T A 6: 9,247,740 V237E probably damaging Het
Olfr622 A C 7: 103,639,802 S113A probably damaging Het
Pla2g12a A G 3: 129,894,942 K150E probably damaging Het
Ptpn23 G A 9: 110,387,075 R1238W probably damaging Het
Pts C T 9: 50,522,278 G124R probably damaging Het
Rfk A T 19: 17,398,638 I99F probably benign Het
Rictor A T 15: 6,750,716 R151* probably null Het
Scn2a T A 2: 65,717,584 I1040N probably benign Het
Serinc5 A C 13: 92,706,202 T387P probably damaging Het
Sh3bp5l A G 11: 58,346,015 Q266R possibly damaging Het
Slc26a3 T A 12: 31,448,843 probably null Het
Slc3a2 G T 19: 8,708,230 H168Q probably benign Het
Smarca2 A T 19: 26,649,122 I449L probably benign Het
Smarcc1 T C 9: 110,196,367 V704A possibly damaging Het
Sox13 A G 1: 133,386,183 probably null Het
Sptbn5 T C 2: 120,072,504 E7G probably damaging Het
Stard10 A G 7: 101,321,903 D26G probably damaging Het
Tap1 A T 17: 34,192,894 R91* probably null Het
Tgfbrap1 A T 1: 43,059,937 V239D possibly damaging Het
Tmem209 A T 6: 30,497,923 Y124* probably null Het
Tmprss2 T A 16: 97,568,983 E327V possibly damaging Het
Ttbk1 T C 17: 46,479,207 Y104C probably damaging Het
Ttll10 A T 4: 156,045,391 F154I probably damaging Het
Ubn2 T A 6: 38,461,477 Y40* probably null Het
Ubr5 A T 15: 38,002,233 S1519T probably benign Het
Ugt3a1 A C 15: 9,306,344 D193A probably damaging Het
Upf1 A T 8: 70,352,978 Y6N probably damaging Het
Vmn2r103 A T 17: 19,794,939 D447V probably benign Het
Vps39 T C 2: 120,325,236 N519S possibly damaging Het
Zfp109 T C 7: 24,229,570 E138G possibly damaging Het
Znrf3 A C 11: 5,286,239 V157G possibly damaging Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78150438 missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78192238 missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78154108 missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78192213 missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78183530 missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78155566 missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78209021 missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78163126 missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78209087 missense probably benign
xi_ning UTSW 18 78195747 missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78205834 start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78157179 nonsense probably null
R1677:Slc14a2 UTSW 18 78163204 missense probably benign
R1749:Slc14a2 UTSW 18 78147080 missense possibly damaging 0.67
R2014:Slc14a2 UTSW 18 78150386 splice site probably benign
R2034:Slc14a2 UTSW 18 78183583 missense probably damaging 0.99
R2264:Slc14a2 UTSW 18 78163089 splice site probably benign
R2278:Slc14a2 UTSW 18 78159944 missense probably benign 0.01
R2920:Slc14a2 UTSW 18 78158297 nonsense probably null
R3878:Slc14a2 UTSW 18 78159074 missense probably benign
R4086:Slc14a2 UTSW 18 78205783 missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4375:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4376:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78195747 missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78195853 missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78195792 missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78155581 missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78192188 missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78150401 missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78195748 missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78157272 missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78185840 missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78208928 missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78159166 missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78209067 missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78147014 missense probably benign 0.23
R5719:Slc14a2 UTSW 18 78209042 missense probably benign 0.06
R6160:Slc14a2 UTSW 18 78158975 critical splice donor site probably null
R6352:Slc14a2 UTSW 18 78209094 start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78146975 missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78154102 missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78159082 missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78192174 missense probably damaging 1.00
R7038:Slc14a2 UTSW 18 78159037 missense probably damaging 0.98
Z1088:Slc14a2 UTSW 18 78195780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATAGGGTTGGGTTAAGAAGGCT -3'
(R):5'- CTCTTTGAAGAGTGAAGGATAGACA -3'

Sequencing Primer
(F):5'- CGCAAACATTAGGACCTGAGCTTG -3'
(R):5'- GAGAAGCTGAGAGTCCTACATCTTC -3'
Posted On2017-01-03