Incidental Mutation 'R5717:Epha2'
ID451208
Institutional Source Beutler Lab
Gene Symbol Epha2
Ensembl Gene ENSMUSG00000006445
Gene NameEph receptor A2
SynonymsMyk2, Eck, Sek-2, Sek2
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R5717 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141301240-141329384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141322071 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 689 (M689L)
Ref Sequence ENSEMBL: ENSMUSP00000006614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006614]
Predicted Effect probably benign
Transcript: ENSMUST00000006614
AA Change: M689L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445
AA Change: M689L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EPH_lbd 27 200 1.31e-112 SMART
FN3 330 420 1.16e-6 SMART
FN3 437 517 3.73e-10 SMART
Pfam:EphA2_TM 538 611 5.9e-22 PFAM
TyrKc 614 872 2.23e-135 SMART
SAM 902 969 1.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149002
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Epha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Epha2 APN 4 141318524 missense probably damaging 1.00
IGL02812:Epha2 APN 4 141318919 splice site probably benign
IGL03377:Epha2 APN 4 141322412 missense probably benign 0.08
R0165:Epha2 UTSW 4 141321892 critical splice donor site probably null
R0321:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R1584:Epha2 UTSW 4 141322047 intron probably null
R1586:Epha2 UTSW 4 141318605 splice site probably benign
R1695:Epha2 UTSW 4 141306517 missense possibly damaging 0.74
R1721:Epha2 UTSW 4 141322652 missense probably damaging 1.00
R1731:Epha2 UTSW 4 141321752 missense possibly damaging 0.81
R1813:Epha2 UTSW 4 141308546 missense possibly damaging 0.86
R1875:Epha2 UTSW 4 141308979 missense probably benign 0.02
R2226:Epha2 UTSW 4 141321237 missense probably damaging 1.00
R2314:Epha2 UTSW 4 141319014 missense probably damaging 1.00
R2342:Epha2 UTSW 4 141323531 missense probably benign 0.00
R3872:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R3927:Epha2 UTSW 4 141306550 missense probably damaging 1.00
R4688:Epha2 UTSW 4 141318981 missense probably benign
R4795:Epha2 UTSW 4 141322416 splice site probably null
R4974:Epha2 UTSW 4 141321705 missense probably damaging 0.99
R5055:Epha2 UTSW 4 141309069 missense probably benign 0.09
R5123:Epha2 UTSW 4 141308865 missense possibly damaging 0.71
R5424:Epha2 UTSW 4 141318940 nonsense probably null
R5522:Epha2 UTSW 4 141308556 missense probably damaging 1.00
R5657:Epha2 UTSW 4 141323494 missense probably damaging 1.00
R5864:Epha2 UTSW 4 141308427 missense probably damaging 0.98
R6151:Epha2 UTSW 4 141318480 critical splice acceptor site probably null
R6244:Epha2 UTSW 4 141316912 missense probably benign 0.00
R6288:Epha2 UTSW 4 141317033 missense probably benign 0.01
R6696:Epha2 UTSW 4 141321539 missense probably benign
R6817:Epha2 UTSW 4 141308994 missense probably damaging 0.98
R6875:Epha2 UTSW 4 141328468 missense probably damaging 1.00
R6910:Epha2 UTSW 4 141321513 missense probably damaging 1.00
R6925:Epha2 UTSW 4 141308757 missense probably benign
R7330:Epha2 UTSW 4 141308453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATCATGGGCCAGTTTAGC -3'
(R):5'- ATGCGATACCCCTCAGCATG -3'

Sequencing Primer
(F):5'- CGTGGTCTCTAAATGTGAGGCC -3'
(R):5'- TGCCCACCAACTGAAGTACACTG -3'
Posted On2017-01-03