Incidental Mutation 'R5717:Vmn1r43'
ID451214
Institutional Source Beutler Lab
Gene Symbol Vmn1r43
Ensembl Gene ENSMUSG00000068231
Gene Namevomeronasal 1 receptor 43
SynonymsV1ra5
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5717 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location89858934-89876413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89869923 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 194 (S194G)
Ref Sequence ENSEMBL: ENSMUSP00000154510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089418] [ENSMUST00000226741] [ENSMUST00000226983] [ENSMUST00000227279] [ENSMUST00000228709]
Predicted Effect probably damaging
Transcript: ENSMUST00000089418
AA Change: S194G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086839
Gene: ENSMUSG00000068231
AA Change: S194G

DomainStartEndE-ValueType
Pfam:V1R 54 318 2.9e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226240
Predicted Effect probably damaging
Transcript: ENSMUST00000226741
AA Change: S194G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226983
AA Change: S194G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000227279
Predicted Effect probably damaging
Transcript: ENSMUST00000228709
AA Change: S194G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Vmn1r43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01748:Vmn1r43 APN 6 89870312 missense probably damaging 1.00
IGL02476:Vmn1r43 APN 6 89870061 missense possibly damaging 0.95
IGL02958:Vmn1r43 APN 6 89870049 missense probably benign 0.09
R0413:Vmn1r43 UTSW 6 89869848 missense probably damaging 1.00
R1662:Vmn1r43 UTSW 6 89869590 missense possibly damaging 0.76
R1668:Vmn1r43 UTSW 6 89869701 missense probably benign 0.01
R4419:Vmn1r43 UTSW 6 89869647 missense probably benign 0.01
R4719:Vmn1r43 UTSW 6 89869855 missense probably benign 0.02
R4798:Vmn1r43 UTSW 6 89869910 missense probably benign 0.01
R5520:Vmn1r43 UTSW 6 89869746 missense probably damaging 0.98
R5643:Vmn1r43 UTSW 6 89870372 missense probably damaging 1.00
R5644:Vmn1r43 UTSW 6 89870372 missense probably damaging 1.00
R6647:Vmn1r43 UTSW 6 89869859 missense probably damaging 1.00
R6914:Vmn1r43 UTSW 6 89870337 missense probably benign 0.02
R6942:Vmn1r43 UTSW 6 89870337 missense probably benign 0.02
R7092:Vmn1r43 UTSW 6 89869903 missense probably benign 0.02
R7402:Vmn1r43 UTSW 6 89869821 missense probably benign 0.02
R7457:Vmn1r43 UTSW 6 89870190 missense probably damaging 0.98
X0020:Vmn1r43 UTSW 6 89870334 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCATGAGCATCAGGATGG -3'
(R):5'- CATTCTTAGTCCCAGAAGCTCC -3'

Sequencing Primer
(F):5'- CATCAGGATGGTCTGGGTAGCAC -3'
(R):5'- GTCCCAGAAGCTCCTGTTTATCAAAG -3'
Posted On2017-01-03