Incidental Mutation 'R5717:Rps25'
ID451219
Institutional Source Beutler Lab
Gene Symbol Rps25
Ensembl Gene ENSMUSG00000009927
Gene Nameribosomal protein S25
Synonyms
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5717 (G1)
Quality Score155
Status Validated
Chromosome9
Chromosomal Location44407139-44410427 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44408750 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 23 (Y23C)
Ref Sequence ENSEMBL: ENSMUSP00000148977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034623] [ENSMUST00000053286] [ENSMUST00000080300] [ENSMUST00000213813] [ENSMUST00000214494] [ENSMUST00000214702] [ENSMUST00000216076] [ENSMUST00000216572] [ENSMUST00000216867] [ENSMUST00000217084] [ENSMUST00000217163] [ENSMUST00000217270] [ENSMUST00000217351]
Predicted Effect probably benign
Transcript: ENSMUST00000034623
SMART Domains Protein: ENSMUSP00000034623
Gene: ENSMUSG00000032112

DomainStartEndE-ValueType
Pfam:Sybindin 3 209 2.7e-63 PFAM
Pfam:Sedlin_N 90 207 2.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053286
SMART Domains Protein: ENSMUSP00000053216
Gene: ENSMUSG00000043923

DomainStartEndE-ValueType
Pfam:CCDC84 6 323 2.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080300
AA Change: Y55C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000079180
Gene: ENSMUSG00000009927
AA Change: Y55C

DomainStartEndE-ValueType
Pfam:Ribosomal_S25 4 112 6.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213747
Predicted Effect probably benign
Transcript: ENSMUST00000213813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214370
Predicted Effect probably benign
Transcript: ENSMUST00000214494
Predicted Effect probably benign
Transcript: ENSMUST00000214702
Predicted Effect probably benign
Transcript: ENSMUST00000214748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215731
Predicted Effect probably benign
Transcript: ENSMUST00000216076
AA Change: Y23C

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216134
Predicted Effect probably benign
Transcript: ENSMUST00000216572
Predicted Effect probably benign
Transcript: ENSMUST00000216867
AA Change: Y55C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000217084
Predicted Effect probably benign
Transcript: ENSMUST00000217163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217231
Predicted Effect probably benign
Transcript: ENSMUST00000217270
Predicted Effect probably benign
Transcript: ENSMUST00000217351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217620
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S25E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Rps25
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1955:Rps25 UTSW 9 44410008 missense probably benign 0.45
R4766:Rps25 UTSW 9 44408749 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CAAGAAGTCTCTAATTTCCCTGAGATG -3'
(R):5'- TTCAAGGACTGCAAAGGAATGC -3'

Sequencing Primer
(F):5'- TCCCTGAGATGATCGTGACAG -3'
(R):5'- GGAAGTCAGTCTATCCTTCATAAGTC -3'
Posted On2017-01-03