Incidental Mutation 'R5717:Wdr72'
ID451222
Institutional Source Beutler Lab
Gene Symbol Wdr72
Ensembl Gene ENSMUSG00000044976
Gene NameWD repeat domain 72
Synonyms
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R5717 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location74110356-74283308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74148205 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 239 (Y239N)
Ref Sequence ENSEMBL: ENSMUSP00000149349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055879] [ENSMUST00000215440]
Predicted Effect probably damaging
Transcript: ENSMUST00000055879
AA Change: Y239N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057320
Gene: ENSMUSG00000044976
AA Change: Y239N

DomainStartEndE-ValueType
WD40 4 45 1.24e0 SMART
WD40 51 93 1.54e0 SMART
WD40 143 188 8.22e1 SMART
Blast:WD40 319 363 4e-19 BLAST
WD40 398 443 8.88e0 SMART
WD40 461 506 5.97e-1 SMART
WD40 509 554 9.9e0 SMART
WD40 557 596 2.12e-3 SMART
low complexity region 694 711 N/A INTRINSIC
low complexity region 780 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215440
AA Change: Y239N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with eight WD-40 repeats. Mutations in this gene have been associated with amelogenesis imperfecta hypomaturation type 2A3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display hypomineralized enamel, ameloblast abnormalities and decreased post-weaning body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Wdr72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Wdr72 APN 9 74155129 missense probably damaging 1.00
IGL01385:Wdr72 APN 9 74179506 splice site probably benign
IGL01512:Wdr72 APN 9 74148759 missense probably benign 0.02
IGL01544:Wdr72 APN 9 74148725 missense probably damaging 1.00
IGL01938:Wdr72 APN 9 74148774 missense probably benign 0.25
IGL02090:Wdr72 APN 9 74154930 missense possibly damaging 0.87
IGL02121:Wdr72 APN 9 74281729 utr 3 prime probably benign
IGL02140:Wdr72 APN 9 74210223 missense probably benign 0.40
IGL02171:Wdr72 APN 9 74210534 missense possibly damaging 0.94
IGL02208:Wdr72 APN 9 74157299 missense probably damaging 1.00
IGL02936:Wdr72 APN 9 74152580 missense probably damaging 1.00
IGL02979:Wdr72 APN 9 74179556 missense probably damaging 1.00
IGL03263:Wdr72 APN 9 74157429 missense probably damaging 1.00
F5770:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
R0107:Wdr72 UTSW 9 74210433 missense probably damaging 1.00
R0332:Wdr72 UTSW 9 74157252 critical splice acceptor site probably null
R0420:Wdr72 UTSW 9 74210757 missense possibly damaging 0.75
R0536:Wdr72 UTSW 9 74157408 missense probably damaging 1.00
R0565:Wdr72 UTSW 9 74217306 missense probably benign 0.34
R0755:Wdr72 UTSW 9 74145094 missense probably benign 0.05
R1183:Wdr72 UTSW 9 74179585 missense probably benign 0.00
R1636:Wdr72 UTSW 9 74179625 missense probably benign 0.00
R1668:Wdr72 UTSW 9 74210162 missense probably damaging 0.99
R1687:Wdr72 UTSW 9 74210199 missense probably benign 0.13
R1813:Wdr72 UTSW 9 74276016 missense possibly damaging 0.85
R1835:Wdr72 UTSW 9 74151617 missense probably damaging 1.00
R2036:Wdr72 UTSW 9 74151594 missense probably damaging 1.00
R2113:Wdr72 UTSW 9 74145172 missense probably benign 0.07
R2331:Wdr72 UTSW 9 74148326 missense probably damaging 1.00
R2369:Wdr72 UTSW 9 74210175 missense possibly damaging 0.77
R3973:Wdr72 UTSW 9 74218697 missense probably benign
R4021:Wdr72 UTSW 9 74151593 missense probably benign 0.18
R4596:Wdr72 UTSW 9 74151605 missense probably benign 0.00
R4665:Wdr72 UTSW 9 74210024 missense probably benign 0.10
R4694:Wdr72 UTSW 9 74179555 missense probably damaging 1.00
R4894:Wdr72 UTSW 9 74210561 missense probably benign 0.00
R5027:Wdr72 UTSW 9 74145976 missense probably damaging 1.00
R5269:Wdr72 UTSW 9 74157371 missense probably damaging 1.00
R5432:Wdr72 UTSW 9 74275946 missense probably damaging 1.00
R5470:Wdr72 UTSW 9 74139699 nonsense probably null
R5793:Wdr72 UTSW 9 74210343 missense probably benign 0.02
R5963:Wdr72 UTSW 9 74145028 missense probably damaging 1.00
R6108:Wdr72 UTSW 9 74151668 missense probably damaging 0.97
R6111:Wdr72 UTSW 9 74210325 missense probably benign 0.00
R6113:Wdr72 UTSW 9 74152641 missense probably benign 0.02
R6245:Wdr72 UTSW 9 74148223 missense probably damaging 1.00
R6469:Wdr72 UTSW 9 74213361 missense probably benign 0.15
R6726:Wdr72 UTSW 9 74152540 missense possibly damaging 0.54
R6857:Wdr72 UTSW 9 74155041 missense probably damaging 1.00
R6916:Wdr72 UTSW 9 74155039 missense probably benign
R6921:Wdr72 UTSW 9 74210646 missense probably benign
R7092:Wdr72 UTSW 9 74210472 missense probably damaging 1.00
R7104:Wdr72 UTSW 9 74148315 missense probably damaging 1.00
V7583:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
X0067:Wdr72 UTSW 9 74152502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTATGTTGGGTTAAACGTGAAAG -3'
(R):5'- TGAATGTTCTGAGCGTCGC -3'

Sequencing Primer
(F):5'- AACGTGAAAGGTTAAGTCTTGTG -3'
(R):5'- AGCGTCGCTCCCATCTGAG -3'
Posted On2017-01-03