Incidental Mutation 'R5717:Cenpj'
ID451234
Institutional Source Beutler Lab
Gene Symbol Cenpj
Ensembl Gene ENSMUSG00000064128
Gene Namecentromere protein J
Synonyms4932437H03Rik, Sas4
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5717 (G1)
Quality Score171
Status Validated
Chromosome14
Chromosomal Location56526761-56575425 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTTTT to GTTTTT at 56553521 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065302] [ENSMUST00000225951]
Predicted Effect probably null
Transcript: ENSMUST00000065302
SMART Domains Protein: ENSMUSP00000065949
Gene: ENSMUSG00000064128

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
coiled coil region 140 185 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
low complexity region 860 871 N/A INTRINSIC
coiled coil region 899 1046 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Pfam:Tcp10_C 1167 1342 5.1e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000225951
Predicted Effect probably benign
Transcript: ENSMUST00000229861
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for null alleles exhibit embryonic lethality during early organogenesis and may show failure of embryo turning and absence of centrioles, cilia and centrosomes. Mice homozygous for a hypomorphic allele display partial lethality, dwarfism and a wide range of abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Cenpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cenpj APN 14 56553030 missense probably benign 0.04
IGL00969:Cenpj APN 14 56564963 missense possibly damaging 0.68
IGL01152:Cenpj APN 14 56552300 missense probably benign 0.01
IGL01475:Cenpj APN 14 56565045 missense possibly damaging 0.80
IGL01548:Cenpj APN 14 56532319 missense probably benign 0.00
IGL01893:Cenpj APN 14 56553474 missense probably damaging 1.00
IGL02647:Cenpj APN 14 56530079 missense probably damaging 0.99
IGL02683:Cenpj APN 14 56552952 missense possibly damaging 0.88
IGL02691:Cenpj APN 14 56552090 missense probably benign 0.28
IGL03008:Cenpj APN 14 56526949 missense probably benign 0.39
R0206:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0208:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0356:Cenpj UTSW 14 56549496 missense probably damaging 1.00
R0942:Cenpj UTSW 14 56555209 unclassified probably benign
R1392:Cenpj UTSW 14 56534854 splice site probably benign
R1564:Cenpj UTSW 14 56552066 missense probably benign 0.43
R1671:Cenpj UTSW 14 56565045 missense probably damaging 0.99
R1889:Cenpj UTSW 14 56558725 missense probably benign 0.43
R2059:Cenpj UTSW 14 56563955 missense possibly damaging 0.94
R2140:Cenpj UTSW 14 56526932 missense probably damaging 1.00
R2509:Cenpj UTSW 14 56532237 missense probably null 0.98
R2866:Cenpj UTSW 14 56552180 missense probably benign 0.01
R3813:Cenpj UTSW 14 56553222 missense probably benign 0.05
R4620:Cenpj UTSW 14 56535454 missense probably damaging 0.99
R4670:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4671:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4765:Cenpj UTSW 14 56549545 nonsense probably null
R4915:Cenpj UTSW 14 56553718 missense probably damaging 0.98
R4930:Cenpj UTSW 14 56534781 nonsense probably null
R5088:Cenpj UTSW 14 56553691 missense probably damaging 1.00
R5523:Cenpj UTSW 14 56552423 missense probably benign 0.00
R5527:Cenpj UTSW 14 56526983 missense probably damaging 1.00
R5944:Cenpj UTSW 14 56553658 critical splice donor site probably null
R5975:Cenpj UTSW 14 56564066 missense possibly damaging 0.92
R6019:Cenpj UTSW 14 56534815 missense probably benign 0.01
R6291:Cenpj UTSW 14 56551976 missense probably benign 0.01
R6948:Cenpj UTSW 14 56553226 missense probably damaging 0.96
R7212:Cenpj UTSW 14 56552652 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCCTTGGGTCTAGCTTTAC -3'
(R):5'- GCAGCAGACATTTGAGGACTAC -3'

Sequencing Primer
(F):5'- GCACACAGGTCTTTATTTATGAGAGC -3'
(R):5'- CTACTTAGAAGAGCAGATCCAACTGG -3'
Posted On2017-01-03