Incidental Mutation 'R5717:Olfr284'
ID451238
Institutional Source Beutler Lab
Gene Symbol Olfr284
Ensembl Gene ENSMUSG00000051793
Gene Nameolfactory receptor 284
SynonymsMOR160-4, GA_x6K02T2NBG7-5395976-5396893
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5717 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98340022-98340987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98340365 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 208 (A208V)
Ref Sequence ENSEMBL: ENSMUSP00000145864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063289] [ENSMUST00000206647]
Predicted Effect probably benign
Transcript: ENSMUST00000063289
AA Change: A192V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065626
Gene: ENSMUSG00000051793
AA Change: A192V

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 5.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 259 1.3e-5 PFAM
Pfam:7tm_1 39 286 5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206647
AA Change: A208V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Olfr284
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr284 APN 15 98340173 missense possibly damaging 0.47
IGL02904:Olfr284 APN 15 98340848 missense probably null 0.88
PIT4378001:Olfr284 UTSW 15 98340272 missense possibly damaging 0.95
R0485:Olfr284 UTSW 15 98340929 missense probably benign 0.01
R1435:Olfr284 UTSW 15 98340328 missense possibly damaging 0.69
R4706:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R4707:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R5272:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5314:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5315:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5316:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5317:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5456:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5458:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5548:Olfr284 UTSW 15 98340372 missense probably benign 0.21
R5921:Olfr284 UTSW 15 98340429 missense probably benign 0.10
R6519:Olfr284 UTSW 15 98340048 missense probably benign 0.00
R6636:Olfr284 UTSW 15 98340950 missense probably benign 0.23
R7112:Olfr284 UTSW 15 98340540 missense possibly damaging 0.81
R7289:Olfr284 UTSW 15 98340062 missense probably damaging 1.00
R7392:Olfr284 UTSW 15 98340311 missense probably benign 0.03
R7403:Olfr284 UTSW 15 98340119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAAGCCGGTAAGAGATAAC -3'
(R):5'- TCTACAGCCAGGTGATGAGTAG -3'

Sequencing Primer
(F):5'- CGGTAAGAGATAACTGATAAACCCCG -3'
(R):5'- CAGGTGATGAGTAGCCAGCTCTG -3'
Posted On2017-01-03