Incidental Mutation 'R5717:Bbs1'
ID451245
Institutional Source Beutler Lab
Gene Symbol Bbs1
Ensembl Gene ENSMUSG00000006464
Gene NameBardet-Biedl syndrome 1 (human)
SynonymsD19Ertd609e
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R5717 (G1)
Quality Score201
Status Validated
Chromosome19
Chromosomal Location4886898-4906627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4897326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 355 (V355A)
Ref Sequence ENSEMBL: ENSMUSP00000055321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053506
AA Change: V355A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055321
Gene: ENSMUSG00000006464
AA Change: V355A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BBS1 23 276 2.7e-104 PFAM
low complexity region 293 305 N/A INTRINSIC
low complexity region 458 466 N/A INTRINSIC
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity after weaning, retinal degeneration, and abnormal olfactory epithelium and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Bbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bbs1 APN 19 4893010 missense probably benign
IGL01110:Bbs1 APN 19 4892925 missense possibly damaging 0.93
IGL01116:Bbs1 APN 19 4902839 splice site probably benign
IGL01480:Bbs1 APN 19 4894393 missense probably damaging 1.00
IGL01926:Bbs1 APN 19 4902863 missense probably benign 0.01
IGL02893:Bbs1 APN 19 4897576 nonsense probably null
IGL03136:Bbs1 APN 19 4890991 missense probably benign 0.10
IGL03342:Bbs1 APN 19 4897593 missense probably damaging 1.00
bookface UTSW 19 4897326 missense possibly damaging 0.81
PIT4131001:Bbs1 UTSW 19 4899259 missense possibly damaging 0.83
PIT4378001:Bbs1 UTSW 19 4891675 missense probably benign 0.05
PIT4468001:Bbs1 UTSW 19 4906162 missense probably benign 0.19
R0023:Bbs1 UTSW 19 4906014 missense probably damaging 1.00
R0023:Bbs1 UTSW 19 4906014 missense probably damaging 1.00
R0127:Bbs1 UTSW 19 4895029 missense probably benign 0.05
R1423:Bbs1 UTSW 19 4894263 missense probably benign 0.08
R1760:Bbs1 UTSW 19 4894322 missense probably benign 0.10
R1992:Bbs1 UTSW 19 4891708 missense probably benign
R2145:Bbs1 UTSW 19 4903707 missense possibly damaging 0.71
R4097:Bbs1 UTSW 19 4897317 missense probably damaging 1.00
R5947:Bbs1 UTSW 19 4892994 missense probably benign 0.27
R6005:Bbs1 UTSW 19 4903795 nonsense probably null
R6175:Bbs1 UTSW 19 4890721 missense probably damaging 1.00
R6597:Bbs1 UTSW 19 4899306 missense probably benign 0.01
R6734:Bbs1 UTSW 19 4903896 missense probably benign 0.10
R6772:Bbs1 UTSW 19 4906590 unclassified probably benign
R6805:Bbs1 UTSW 19 4900615 missense probably damaging 1.00
R6838:Bbs1 UTSW 19 4903852 missense possibly damaging 0.47
R7198:Bbs1 UTSW 19 4895015 missense probably damaging 0.97
Y5404:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Y5407:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGTATTTCTAAGGCCCATCCCTATG -3'
(R):5'- CCTTATTTCCGCGTGAAGCC -3'

Sequencing Primer
(F):5'- GTGTTGCCACCAGTAAACTG -3'
(R):5'- TATTTCCGCGTGAAGCCCTGAG -3'
Posted On2017-01-03