Incidental Mutation 'R5718:Arhgef7'
ID451280
Institutional Source Beutler Lab
Gene Symbol Arhgef7
Ensembl Gene ENSMUSG00000031511
Gene NameRho guanine nucleotide exchange factor (GEF7)
Synonymscool-1, betaPix, Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-b, betaPix-c
MMRRC Submission 043338-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R5718 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location11727721-11835219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11785774 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 20 (T20I)
Ref Sequence ENSEMBL: ENSMUSP00000074399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074856] [ENSMUST00000098938] [ENSMUST00000110904] [ENSMUST00000110909] [ENSMUST00000210012] [ENSMUST00000210104] [ENSMUST00000211409]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000033908
SMART Domains Protein: ENSMUSP00000033908
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
low complexity region 600 614 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 660 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074856
AA Change: T20I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074399
Gene: ENSMUSG00000031511
AA Change: T20I

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
PDB:3L4F|C 587 646 2e-32 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000098938
AA Change: T20I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096538
Gene: ENSMUSG00000031511
AA Change: T20I

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
low complexity region 569 600 N/A INTRINSIC
PDB:3L4F|C 646 705 2e-32 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000110904
AA Change: T26I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106529
Gene: ENSMUSG00000031511
AA Change: T26I

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 428 440 N/A INTRINSIC
low complexity region 494 525 N/A INTRINSIC
PDB:3L4F|C 571 630 2e-32 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000110909
AA Change: T177I

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106534
Gene: ENSMUSG00000031511
AA Change: T177I

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
Pfam:RhoGEF67_u1 117 163 8e-21 PFAM
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
Pfam:RhoGEF67_u2 611 711 2.3e-53 PFAM
low complexity region 726 757 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209686
Predicted Effect possibly damaging
Transcript: ENSMUST00000210012
AA Change: T20I

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000210104
Predicted Effect probably benign
Transcript: ENSMUST00000211409
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of cytoplasmic proteins that activate the Ras-like family of Rho proteins by exchanging bound GDP for GTP. It forms a complex with the small GTP binding protein Rac1 and recruits Rac1 to membrane ruffles and to focal adhesions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,113,486 probably null Het
Ahctf1 G T 1: 179,769,339 H81N possibly damaging Het
Alyref2 T C 1: 171,504,110 S152P possibly damaging Het
Armc3 T G 2: 19,303,799 Y759* probably null Het
Atg5 A G 10: 44,362,987 S255G probably benign Het
Atp11b A G 3: 35,837,516 I1026V probably benign Het
Atp1a2 C A 1: 172,279,442 K770N probably damaging Het
Bptf G T 11: 107,111,434 A284E probably damaging Het
Celsr2 A G 3: 108,393,358 S815P probably benign Het
Chrna5 A G 9: 54,998,105 H67R probably benign Het
Cic A G 7: 25,272,778 I645V probably benign Het
Clpx A T 9: 65,299,964 Q48L probably benign Het
Crhr2 G A 6: 55,092,100 Q397* probably null Het
Cyp11a1 G A 9: 58,018,225 V48I probably benign Het
Dchs1 C T 7: 105,755,748 R2529H probably benign Het
Dnah7c A T 1: 46,748,666 H3293L possibly damaging Het
Dock6 G T 9: 21,824,493 D986E probably benign Het
Efcab6 T A 15: 83,904,238 N952Y probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epg5 G A 18: 77,986,403 C1327Y probably damaging Het
Fbxw18 T C 9: 109,691,568 E241G probably benign Het
Fsd1 T G 17: 55,990,542 probably benign Het
Gcnt3 A G 9: 70,034,270 S339P probably benign Het
Gldc T A 19: 30,110,772 K829* probably null Het
Gli3 G A 13: 15,478,165 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Hmcn1 A T 1: 150,609,666 I4395N probably damaging Het
Hmcn1 A T 1: 150,690,600 C2217* probably null Het
Hmgxb3 A G 18: 61,140,837 M861T probably benign Het
Ift172 A G 5: 31,255,277 S1545P possibly damaging Het
Jak3 C A 8: 71,684,354 L725M probably damaging Het
Lrig2 A T 3: 104,468,615 C90* probably null Het
Mcm7 C T 5: 138,164,819 R357H possibly damaging Het
Mcoln2 T C 3: 146,181,826 S333P probably damaging Het
Mrpl22 A T 11: 58,177,283 I136L probably benign Het
Ncam2 A T 16: 81,589,814 probably null Het
Ncdn G A 4: 126,749,950 Q360* probably null Het
Nsun2 A G 13: 69,623,284 K338E probably benign Het
Obscn T C 11: 59,036,808 T6105A probably damaging Het
Olfr171 G A 16: 19,624,389 S237F probably benign Het
Olfr957 A T 9: 39,511,042 L226H probably damaging Het
Pcnx4 T A 12: 72,567,194 F638I possibly damaging Het
Pfn3 T C 13: 55,415,040 I43V probably benign Het
Pigm C A 1: 172,377,445 probably null Het
Pkhd1l1 T A 15: 44,545,417 S2433R probably damaging Het
Pomt1 C A 2: 32,248,692 A440D possibly damaging Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qrich1 T A 9: 108,528,823 S72T probably damaging Het
Ralgapa2 T A 2: 146,453,406 probably null Het
Rarg A C 15: 102,241,067 S156A probably damaging Het
Rasl11a A G 5: 146,847,144 K133R probably benign Het
Rcor1 A G 12: 111,101,635 D158G probably benign Het
Rpn2 C T 2: 157,321,827 T613M probably damaging Het
Sipa1l2 T A 8: 125,491,248 H450L probably damaging Het
Slc25a21 T C 12: 56,718,156 I263V probably benign Het
Slc25a32 A T 15: 39,097,562 V242E probably benign Het
Slc5a5 T A 8: 70,887,755 T484S probably benign Het
Tdrd3 T C 14: 87,506,440 V608A probably benign Het
Thnsl1 C A 2: 21,212,000 H188Q possibly damaging Het
Tshz1 A T 18: 84,014,524 H586Q probably damaging Het
Vmn2r27 C T 6: 124,192,144 A676T possibly damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xbp1 T A 11: 5,521,903 F10I probably benign Het
Zbtb1 G A 12: 76,386,924 M561I probably benign Het
Zfp708 T C 13: 67,070,458 K446E probably benign Het
Other mutations in Arhgef7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgef7 APN 8 11782540 missense probably damaging 1.00
IGL01481:Arhgef7 APN 8 11815256 missense probably benign 0.01
IGL02376:Arhgef7 APN 8 11817735 missense probably damaging 1.00
IGL02812:Arhgef7 APN 8 11781245 unclassified probably benign
IGL02813:Arhgef7 APN 8 11800767 unclassified probably benign
IGL02864:Arhgef7 APN 8 11815247 missense possibly damaging 0.49
Mental_fitness UTSW 8 11800811 missense probably damaging 1.00
R0139:Arhgef7 UTSW 8 11800503 missense probably damaging 0.99
R0157:Arhgef7 UTSW 8 11785812 missense probably damaging 1.00
R0332:Arhgef7 UTSW 8 11824701 nonsense probably null
R0448:Arhgef7 UTSW 8 11819659 missense possibly damaging 0.78
R0973:Arhgef7 UTSW 8 11819659 missense possibly damaging 0.78
R1491:Arhgef7 UTSW 8 11819733 critical splice donor site probably null
R1566:Arhgef7 UTSW 8 11782620 missense possibly damaging 0.85
R1601:Arhgef7 UTSW 8 11782638 unclassified probably null
R1716:Arhgef7 UTSW 8 11808713 splice site probably null
R1717:Arhgef7 UTSW 8 11808712 unclassified probably benign
R1717:Arhgef7 UTSW 8 11808713 splice site probably null
R1719:Arhgef7 UTSW 8 11808713 splice site probably null
R1901:Arhgef7 UTSW 8 11808713 splice site probably null
R1902:Arhgef7 UTSW 8 11808713 splice site probably null
R1933:Arhgef7 UTSW 8 11808713 splice site probably null
R1934:Arhgef7 UTSW 8 11808713 splice site probably null
R1956:Arhgef7 UTSW 8 11805266 missense probably damaging 1.00
R2122:Arhgef7 UTSW 8 11728256 missense possibly damaging 0.94
R2273:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2275:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2306:Arhgef7 UTSW 8 11812680 nonsense probably null
R2375:Arhgef7 UTSW 8 11814995 missense probably benign 0.08
R4530:Arhgef7 UTSW 8 11800802 missense possibly damaging 0.60
R4805:Arhgef7 UTSW 8 11831552 missense probably damaging 1.00
R5204:Arhgef7 UTSW 8 11800775 nonsense probably null
R5212:Arhgef7 UTSW 8 11728388 missense probably benign 0.40
R5256:Arhgef7 UTSW 8 11800811 missense probably damaging 1.00
R6195:Arhgef7 UTSW 8 11822017 missense probably damaging 1.00
R6503:Arhgef7 UTSW 8 11833054 missense possibly damaging 0.58
R6679:Arhgef7 UTSW 8 11824667 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCTGACTGGTCAAGGTGCAC -3'
(R):5'- AGGCTTCTCCCAAAGTCAGG -3'

Sequencing Primer
(F):5'- TGGCCTGGAACTCAGATCCAC -3'
(R):5'- AGGCTTCTCCCAAAGTCAGGTTTAG -3'
Posted On2017-01-03