Incidental Mutation 'R5718:Adgra2'
ID451281
Institutional Source Beutler Lab
Gene Symbol Adgra2
Ensembl Gene ENSMUSG00000031486
Gene Nameadhesion G protein-coupled receptor A2
SynonymsTem5, 8430414O08Rik, Gpr124, 9530074E10Rik
MMRRC Submission 043338-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5718 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location27085583-27123436 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 27113486 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033876] [ENSMUST00000178514] [ENSMUST00000179351]
Predicted Effect probably null
Transcript: ENSMUST00000033876
SMART Domains Protein: ENSMUSP00000033876
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 1.06e2 SMART
LRR_TYP 107 130 2.71e-2 SMART
LRR_TYP 131 154 1.28e-3 SMART
LRR 155 178 7.38e1 SMART
LRRCT 190 240 4.63e-6 SMART
IG 253 346 3.49e-3 SMART
low complexity region 629 639 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Pfam:GPS 709 750 1.1e-7 PFAM
Pfam:7tm_2 770 990 5.3e-13 PFAM
transmembrane domain 1016 1038 N/A INTRINSIC
transmembrane domain 1045 1064 N/A INTRINSIC
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1110 1129 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178514
SMART Domains Protein: ENSMUSP00000136277
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 4.4e-1 SMART
LRR_TYP 107 130 1.1e-4 SMART
LRR_TYP 131 154 5.3e-6 SMART
LRR 155 178 3.1e-1 SMART
LRRCT 190 240 2.2e-8 SMART
IG 253 346 1.4e-5 SMART
HormR 349 426 1.8e-4 SMART
Pfam:7tm_2 554 775 3.2e-11 PFAM
transmembrane domain 801 823 N/A INTRINSIC
transmembrane domain 830 849 N/A INTRINSIC
low complexity region 860 880 N/A INTRINSIC
low complexity region 895 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179207
Predicted Effect probably benign
Transcript: ENSMUST00000179351
SMART Domains Protein: ENSMUSP00000137457
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
Pfam:GPS 5 49 4.5e-11 PFAM
transmembrane domain 67 89 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display fetal or perinatal lethality with CNS hemorrhage and angiogenic arrest in the CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,769,339 H81N possibly damaging Het
Alyref2 T C 1: 171,504,110 S152P possibly damaging Het
Arhgef7 C T 8: 11,785,774 T20I probably damaging Het
Armc3 T G 2: 19,303,799 Y759* probably null Het
Atg5 A G 10: 44,362,987 S255G probably benign Het
Atp11b A G 3: 35,837,516 I1026V probably benign Het
Atp1a2 C A 1: 172,279,442 K770N probably damaging Het
Bptf G T 11: 107,111,434 A284E probably damaging Het
Celsr2 A G 3: 108,393,358 S815P probably benign Het
Chrna5 A G 9: 54,998,105 H67R probably benign Het
Cic A G 7: 25,272,778 I645V probably benign Het
Clpx A T 9: 65,299,964 Q48L probably benign Het
Crhr2 G A 6: 55,092,100 Q397* probably null Het
Cyp11a1 G A 9: 58,018,225 V48I probably benign Het
Dchs1 C T 7: 105,755,748 R2529H probably benign Het
Dnah7c A T 1: 46,748,666 H3293L possibly damaging Het
Dock6 G T 9: 21,824,493 D986E probably benign Het
Efcab6 T A 15: 83,904,238 N952Y probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epg5 G A 18: 77,986,403 C1327Y probably damaging Het
Fbxw18 T C 9: 109,691,568 E241G probably benign Het
Fsd1 T G 17: 55,990,542 probably benign Het
Gcnt3 A G 9: 70,034,270 S339P probably benign Het
Gldc T A 19: 30,110,772 K829* probably null Het
Gli3 G A 13: 15,478,165 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Hmcn1 A T 1: 150,609,666 I4395N probably damaging Het
Hmcn1 A T 1: 150,690,600 C2217* probably null Het
Hmgxb3 A G 18: 61,140,837 M861T probably benign Het
Ift172 A G 5: 31,255,277 S1545P possibly damaging Het
Jak3 C A 8: 71,684,354 L725M probably damaging Het
Lrig2 A T 3: 104,468,615 C90* probably null Het
Mcm7 C T 5: 138,164,819 R357H possibly damaging Het
Mcoln2 T C 3: 146,181,826 S333P probably damaging Het
Mrpl22 A T 11: 58,177,283 I136L probably benign Het
Ncam2 A T 16: 81,589,814 probably null Het
Ncdn G A 4: 126,749,950 Q360* probably null Het
Nsun2 A G 13: 69,623,284 K338E probably benign Het
Obscn T C 11: 59,036,808 T6105A probably damaging Het
Olfr171 G A 16: 19,624,389 S237F probably benign Het
Olfr957 A T 9: 39,511,042 L226H probably damaging Het
Pcnx4 T A 12: 72,567,194 F638I possibly damaging Het
Pfn3 T C 13: 55,415,040 I43V probably benign Het
Pigm C A 1: 172,377,445 probably null Het
Pkhd1l1 T A 15: 44,545,417 S2433R probably damaging Het
Pomt1 C A 2: 32,248,692 A440D possibly damaging Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qrich1 T A 9: 108,528,823 S72T probably damaging Het
Ralgapa2 T A 2: 146,453,406 probably null Het
Rarg A C 15: 102,241,067 S156A probably damaging Het
Rasl11a A G 5: 146,847,144 K133R probably benign Het
Rcor1 A G 12: 111,101,635 D158G probably benign Het
Rpn2 C T 2: 157,321,827 T613M probably damaging Het
Sipa1l2 T A 8: 125,491,248 H450L probably damaging Het
Slc25a21 T C 12: 56,718,156 I263V probably benign Het
Slc25a32 A T 15: 39,097,562 V242E probably benign Het
Slc5a5 T A 8: 70,887,755 T484S probably benign Het
Tdrd3 T C 14: 87,506,440 V608A probably benign Het
Thnsl1 C A 2: 21,212,000 H188Q possibly damaging Het
Tshz1 A T 18: 84,014,524 H586Q probably damaging Het
Vmn2r27 C T 6: 124,192,144 A676T possibly damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xbp1 T A 11: 5,521,903 F10I probably benign Het
Zbtb1 G A 12: 76,386,924 M561I probably benign Het
Zfp708 T C 13: 67,070,458 K446E probably benign Het
Other mutations in Adgra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Adgra2 APN 8 27085983 missense possibly damaging 0.81
IGL01599:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01627:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01629:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01632:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01968:Adgra2 APN 8 27121235 nonsense probably null
IGL02551:Adgra2 APN 8 27119222 missense probably benign
IGL02820:Adgra2 APN 8 27117507 missense probably damaging 1.00
R0735:Adgra2 UTSW 8 27117318 missense probably damaging 1.00
R0799:Adgra2 UTSW 8 27112495 missense probably damaging 1.00
R1183:Adgra2 UTSW 8 27114388 missense probably damaging 1.00
R1276:Adgra2 UTSW 8 27119824 missense probably damaging 0.99
R1389:Adgra2 UTSW 8 27111088 missense probably damaging 1.00
R1514:Adgra2 UTSW 8 27121278 nonsense probably null
R1601:Adgra2 UTSW 8 27110018 splice site probably null
R1760:Adgra2 UTSW 8 27119767 missense probably damaging 1.00
R1957:Adgra2 UTSW 8 27111168 missense possibly damaging 0.64
R1977:Adgra2 UTSW 8 27115761 missense possibly damaging 0.80
R2164:Adgra2 UTSW 8 27114204 nonsense probably null
R2181:Adgra2 UTSW 8 27121673 missense probably damaging 0.99
R4282:Adgra2 UTSW 8 27119244 missense possibly damaging 0.54
R4724:Adgra2 UTSW 8 27098822 missense possibly damaging 0.91
R4749:Adgra2 UTSW 8 27114197 missense probably damaging 1.00
R4809:Adgra2 UTSW 8 27110479 nonsense probably null
R6025:Adgra2 UTSW 8 27114463 missense probably damaging 0.99
R6078:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6079:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6138:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6140:Adgra2 UTSW 8 27115405 missense probably damaging 1.00
R6232:Adgra2 UTSW 8 27119165 missense probably benign 0.19
R6321:Adgra2 UTSW 8 27114162 missense probably benign 0.02
R6385:Adgra2 UTSW 8 27118850 missense probably damaging 1.00
R6676:Adgra2 UTSW 8 27111240 missense possibly damaging 0.50
R6724:Adgra2 UTSW 8 27114182 missense possibly damaging 0.93
R6862:Adgra2 UTSW 8 27113436 missense probably benign 0.01
R6862:Adgra2 UTSW 8 27113437 missense probably damaging 0.98
R7140:Adgra2 UTSW 8 27120901 critical splice donor site probably null
R7242:Adgra2 UTSW 8 27122027 missense probably damaging 1.00
X0050:Adgra2 UTSW 8 27113418 missense probably benign 0.32
X0062:Adgra2 UTSW 8 27120806 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACCAGTCCTGTTTACAGTACCC -3'
(R):5'- TCAGTCCACAGTCCTTGCTG -3'

Sequencing Primer
(F):5'- AGTCCTGTTTACAGTACCCCTTCAC -3'
(R):5'- GTACCCACTCTTAATGCAC -3'
Posted On2017-01-03