Incidental Mutation 'R0551:Mfsd4a'
ID45138
Institutional Source Beutler Lab
Gene Symbol Mfsd4a
Ensembl Gene ENSMUSG00000059149
Gene Namemajor facilitator superfamily domain containing 4A
SynonymsMfsd4, A930031D07Rik
MMRRC Submission 038743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0551 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132022806-132068062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132041919 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 348 (T348I)
Ref Sequence ENSEMBL: ENSMUSP00000124961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046658] [ENSMUST00000112365] [ENSMUST00000112370] [ENSMUST00000126927] [ENSMUST00000144548] [ENSMUST00000146267] [ENSMUST00000159038] [ENSMUST00000160656] [ENSMUST00000161864]
Predicted Effect probably damaging
Transcript: ENSMUST00000046658
AA Change: T280I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039635
Gene: ENSMUSG00000059149
AA Change: T280I

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 99 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 245 267 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 309 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112365
SMART Domains Protein: ENSMUSP00000107984
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
Pfam:MFS_1 21 430 1.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112370
AA Change: T432I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107989
Gene: ENSMUSG00000059149
AA Change: T432I

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126927
AA Change: T432I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116706
Gene: ENSMUSG00000059149
AA Change: T432I

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144548
AA Change: T432I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116282
Gene: ENSMUSG00000059149
AA Change: T432I

DomainStartEndE-ValueType
Pfam:MFS_1 21 396 4.2e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146267
SMART Domains Protein: ENSMUSP00000117864
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159038
AA Change: T432I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125558
Gene: ENSMUSG00000059149
AA Change: T432I

DomainStartEndE-ValueType
Pfam:MFS_1 20 395 6.8e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159382
Predicted Effect probably benign
Transcript: ENSMUST00000160656
AA Change: T326I

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125138
Gene: ENSMUSG00000059149
AA Change: T326I

DomainStartEndE-ValueType
transmembrane domain 2 20 N/A INTRINSIC
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 85 104 N/A INTRINSIC
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
transmembrane domain 354 376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161864
AA Change: T348I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124961
Gene: ENSMUSG00000059149
AA Change: T348I

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
Pfam:MFS_1 218 420 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189227
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Auts2 T C 5: 131,440,469 E446G possibly damaging Het
Brwd1 C T 16: 96,035,974 R886H probably damaging Het
Carm1 G A 9: 21,580,491 probably null Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Clca4b T A 3: 144,928,626 T69S probably damaging Het
Cpox A G 16: 58,675,390 I357V probably benign Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Ganab T G 19: 8,907,280 I149S probably benign Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Klkb1 A G 8: 45,277,966 probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Manba T C 3: 135,517,973 I207T probably damaging Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tiam2 T A 17: 3,428,954 M654K probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Mfsd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Mfsd4a APN 1 132040594 missense probably benign 0.34
IGL01348:Mfsd4a APN 1 132067826 missense probably null 0.96
IGL01621:Mfsd4a APN 1 132054143 missense probably benign 0.16
IGL01934:Mfsd4a APN 1 132046311 missense probably damaging 1.00
IGL02429:Mfsd4a APN 1 132028499 missense probably benign
R0362:Mfsd4a UTSW 1 132059275 missense probably damaging 1.00
R1435:Mfsd4a UTSW 1 132067756 missense probably damaging 1.00
R1566:Mfsd4a UTSW 1 132059179 missense probably damaging 1.00
R1739:Mfsd4a UTSW 1 132067883 missense possibly damaging 0.85
R1793:Mfsd4a UTSW 1 132059339 missense probably damaging 0.98
R1799:Mfsd4a UTSW 1 132053596 missense possibly damaging 0.63
R2244:Mfsd4a UTSW 1 132028505 missense probably benign 0.09
R3870:Mfsd4a UTSW 1 132046353 missense probably damaging 0.99
R4177:Mfsd4a UTSW 1 132040557 missense probably damaging 0.99
R4330:Mfsd4a UTSW 1 132053553 missense possibly damaging 0.71
R4705:Mfsd4a UTSW 1 132053571 missense probably damaging 1.00
R4717:Mfsd4a UTSW 1 132057895 missense probably benign 0.00
R5886:Mfsd4a UTSW 1 132067727 missense probably damaging 0.96
R5890:Mfsd4a UTSW 1 132038928 missense probably damaging 1.00
R7092:Mfsd4a UTSW 1 132067663 missense
Predicted Primers PCR Primer
(F):5'- TCCTCAAGCTATGTGGAACTCAGGAA -3'
(R):5'- ACAGTCCCAAAGTTGTCACAGATCAAAG -3'

Sequencing Primer
(F):5'- CTCAGGAAGTGACCGCTTAGAC -3'
(R):5'- acacattccagagcaggtag -3'
Posted On2013-06-11