Incidental Mutation 'R5720:Arhgef10l'
List |< first << previous [record 45 of 585] next >> last >|
ID451402
Institutional Source Beutler Lab
Gene Symbol Arhgef10l
Ensembl Gene ENSMUSG00000040964
Gene NameRho guanine nucleotide exchange factor (GEF) 10-like
Synonyms2810441C07Rik
MMRRC Submission 043188-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R5720 (G1)
Quality Score135
Status Not validated
Chromosome4
Chromosomal Location140514485-140666012 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGA at 140581619 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039204] [ENSMUST00000069623] [ENSMUST00000097820] [ENSMUST00000105797] [ENSMUST00000105798] [ENSMUST00000105799] [ENSMUST00000147426]
Predicted Effect probably benign
Transcript: ENSMUST00000039204
SMART Domains Protein: ENSMUSP00000040531
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 748 3e-82 BLAST
low complexity region 821 833 N/A INTRINSIC
low complexity region 864 876 N/A INTRINSIC
Blast:WD40 1217 1270 8e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000069623
SMART Domains Protein: ENSMUSP00000066249
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 714 5e-80 BLAST
low complexity region 787 799 N/A INTRINSIC
low complexity region 830 842 N/A INTRINSIC
Blast:WD40 1183 1236 7e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000097820
SMART Domains Protein: ENSMUSP00000095431
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 709 3e-82 BLAST
low complexity region 782 794 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
Blast:WD40 1178 1231 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105797
SMART Domains Protein: ENSMUSP00000101423
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
Pfam:RhoGEF 101 183 7.1e-15 PFAM
low complexity region 195 213 N/A INTRINSIC
Blast:PH 248 461 7e-83 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 577 589 N/A INTRINSIC
Blast:WD40 618 656 6e-15 BLAST
Blast:WD40 930 983 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105798
SMART Domains Protein: ENSMUSP00000101424
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
RhoGEF 78 260 1.95e-52 SMART
Blast:PH 295 513 8e-81 BLAST
low complexity region 586 598 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
Blast:WD40 982 1035 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105799
SMART Domains Protein: ENSMUSP00000101425
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 753 5e-80 BLAST
low complexity region 826 838 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Blast:WD40 1222 1275 8e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125045
Predicted Effect probably benign
Transcript: ENSMUST00000138493
SMART Domains Protein: ENSMUSP00000119471
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
Pfam:RhoGEF 1 46 3.1e-11 PFAM
Blast:PH 81 294 3e-86 BLAST
low complexity region 367 379 N/A INTRINSIC
Blast:WD40 387 446 8e-6 BLAST
Blast:WD40 451 489 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147426
SMART Domains Protein: ENSMUSP00000123642
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
RhoGEF 101 262 5.44e-33 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RhoGEF subfamily of RhoGTPases. Members of this subfamily are activated by specific guanine nucleotide exchange factors (GEFs) and are involved in signal transduction. The encoded protein shows cytosolic distribution. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,203,687 N1165K probably benign Het
BC037034 A G 5: 138,263,702 V44A probably benign Het
Cdh23 T C 10: 60,393,023 T1125A possibly damaging Het
Ctf1 A T 7: 127,717,002 probably null Het
Defb26 T C 2: 152,508,202 N53D possibly damaging Het
Dhtkd1 T C 2: 5,903,014 T787A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxl7 A G 15: 26,552,893 L96P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr65 A T 12: 98,275,102 S5C probably damaging Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Itga8 G A 2: 12,111,087 S76L probably damaging Het
Mpdz A T 4: 81,287,694 F1810Y probably damaging Het
Nfrkb T C 9: 31,394,742 L126P probably damaging Het
Olfr1250 T C 2: 89,656,955 Y162C probably benign Het
Primpol A G 8: 46,581,642 V417A probably damaging Het
Pus1 C T 5: 110,777,718 E79K probably damaging Het
Rspo2 C T 15: 43,169,814 C4Y probably benign Het
Serpina12 T C 12: 104,038,304 D23G probably benign Het
Serpind1 A T 16: 17,339,832 R297S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc17a6 C T 7: 51,625,397 P68L probably damaging Het
Slc6a5 C T 7: 49,956,516 P724L possibly damaging Het
Spaca7 A G 8: 12,599,004 E166G possibly damaging Het
Supt5 A G 7: 28,322,568 S345P probably damaging Het
Syne2 G A 12: 75,967,667 D3211N probably benign Het
Tmem132e G A 11: 82,442,450 probably null Het
Zfp384 T C 6: 125,036,624 S536P probably benign Het
Other mutations in Arhgef10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Arhgef10l APN 4 140570338 missense probably damaging 0.98
IGL01732:Arhgef10l APN 4 140580415 missense probably damaging 0.99
IGL01988:Arhgef10l APN 4 140578361 splice site probably benign
IGL02031:Arhgef10l APN 4 140575345 missense probably damaging 1.00
IGL02253:Arhgef10l APN 4 140544284 nonsense probably null
IGL02445:Arhgef10l APN 4 140547007 missense probably benign 0.19
IGL02619:Arhgef10l APN 4 140594193 missense probably benign 0.07
IGL02798:Arhgef10l APN 4 140565130 critical splice donor site probably null
IGL03064:Arhgef10l APN 4 140579279 missense probably damaging 1.00
IGL03178:Arhgef10l APN 4 140544428 missense possibly damaging 0.92
IGL03236:Arhgef10l APN 4 140611360 missense probably damaging 1.00
IGL03352:Arhgef10l APN 4 140583931 start codon destroyed probably null 0.99
R0057:Arhgef10l UTSW 4 140611218 splice site probably benign
R0062:Arhgef10l UTSW 4 140552532 missense probably damaging 1.00
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0114:Arhgef10l UTSW 4 140583883 missense probably benign 0.17
R0334:Arhgef10l UTSW 4 140583926 nonsense probably null
R0742:Arhgef10l UTSW 4 140536845 missense probably damaging 1.00
R1017:Arhgef10l UTSW 4 140515306 missense probably damaging 0.99
R1166:Arhgef10l UTSW 4 140575270 unclassified probably benign
R1397:Arhgef10l UTSW 4 140544443 missense probably damaging 0.98
R1521:Arhgef10l UTSW 4 140515438 missense possibly damaging 0.95
R1707:Arhgef10l UTSW 4 140564289 missense probably damaging 1.00
R1793:Arhgef10l UTSW 4 140515373 missense probably damaging 0.97
R2018:Arhgef10l UTSW 4 140544384 missense probably damaging 1.00
R2093:Arhgef10l UTSW 4 140570290 missense possibly damaging 0.57
R2098:Arhgef10l UTSW 4 140579432 missense probably damaging 1.00
R2310:Arhgef10l UTSW 4 140593118 missense probably damaging 1.00
R2879:Arhgef10l UTSW 4 140515287 missense probably benign 0.09
R2883:Arhgef10l UTSW 4 140516802 missense probably benign 0.02
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3861:Arhgef10l UTSW 4 140515487 missense possibly damaging 0.94
R4049:Arhgef10l UTSW 4 140515451 missense probably benign 0.05
R4322:Arhgef10l UTSW 4 140542726 missense probably benign 0.07
R4707:Arhgef10l UTSW 4 140536883 missense possibly damaging 0.63
R5395:Arhgef10l UTSW 4 140570290 missense probably benign 0.16
R6066:Arhgef10l UTSW 4 140577080 missense probably damaging 1.00
R6190:Arhgef10l UTSW 4 140542762 missense possibly damaging 0.90
R6464:Arhgef10l UTSW 4 140586815 missense probably benign 0.05
R6476:Arhgef10l UTSW 4 140611382 missense probably damaging 1.00
R6478:Arhgef10l UTSW 4 140542757 missense possibly damaging 0.91
R6483:Arhgef10l UTSW 4 140616915 missense probably damaging 0.99
R6721:Arhgef10l UTSW 4 140570344 missense probably damaging 1.00
R6890:Arhgef10l UTSW 4 140544419 missense probably damaging 1.00
Z1088:Arhgef10l UTSW 4 140581735 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AAACCATCAGCTTTGCACTTCC -3'
(R):5'- GGCCAAGAATGTTACCCAGC -3'

Sequencing Primer
(F):5'- ATCCTTCCAGGCTCCGAG -3'
(R):5'- GAATGTTACCCAGCAGCTCATGG -3'
Posted On2017-01-03