Incidental Mutation 'R5721:Slc6a20b'
ID451448
Institutional Source Beutler Lab
Gene Symbol Slc6a20b
Ensembl Gene ENSMUSG00000025243
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 20B
SynonymsSit1, XT3, Xtrp3, Slc6a20
MMRRC Submission 043189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5721 (G1)
Quality Score184
Status Not validated
Chromosome9
Chromosomal Location123590800-123632565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123611989 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 131 (G131C)
Ref Sequence ENSEMBL: ENSMUSP00000026273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026273] [ENSMUST00000166800]
Predicted Effect probably null
Transcript: ENSMUST00000026273
AA Change: G131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026273
Gene: ENSMUSG00000025243
AA Change: G131C

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:SNF 48 624 5.4e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163397
SMART Domains Protein: ENSMUSP00000127422
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
Pfam:SNF 23 59 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164241
Predicted Effect probably damaging
Transcript: ENSMUST00000166800
AA Change: G131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000168824
SMART Domains Protein: ENSMUSP00000129307
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:SNF 38 74 3.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171122
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,597 V30D probably damaging Het
Atl3 T A 19: 7,529,011 M302K probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Ciz1 C T 2: 32,376,040 T39I probably damaging Het
Cog8 T C 8: 107,050,148 T532A probably benign Het
Ctsr C T 13: 61,161,853 G181S possibly damaging Het
Drc7 T C 8: 95,074,333 probably null Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Faf1 T C 4: 109,935,666 F612L probably benign Het
Fbxo40 T A 16: 36,968,934 M605L probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gprc6a A T 10: 51,614,980 M716K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Jcad A T 18: 4,676,044 T1269S possibly damaging Het
Kif23 C G 9: 61,944,216 G66A probably benign Het
Lrrd1 T C 5: 3,850,619 M308T probably benign Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Mcph1 G A 8: 18,671,207 V684M probably damaging Het
Mpv17l T C 16: 13,946,794 Y62H probably damaging Het
Olfr270 G T 4: 52,971,068 W149L probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Osgepl1 A T 1: 53,321,200 M362L possibly damaging Het
P2ry14 T C 3: 59,115,031 probably null Het
Pacsin3 T A 2: 91,264,235 C402S probably damaging Het
Papss2 A G 19: 32,660,664 Y392C probably damaging Het
Plekha8 T A 6: 54,613,106 W19R probably damaging Het
Prdm15 A T 16: 97,807,096 I667N possibly damaging Het
Rab11fip2 A G 19: 59,935,610 S279P probably damaging Het
Suox T C 10: 128,671,293 I289V possibly damaging Het
Tbc1d16 C T 11: 119,158,730 probably null Het
Tmem269 T C 4: 119,209,949 T146A probably benign Het
Ttc30a1 A T 2: 75,981,371 Y123N probably damaging Het
Ttn G A 2: 76,728,567 R29657W probably damaging Het
Vmn1r84 C A 7: 12,362,226 C168F probably damaging Het
Zc3h7b T C 15: 81,773,298 F180L probably benign Het
Zfand4 C G 6: 116,287,995 D140E probably damaging Het
Other mutations in Slc6a20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Slc6a20b APN 9 123597240 missense probably damaging 1.00
IGL02741:Slc6a20b APN 9 123607602 missense probably damaging 1.00
IGL03038:Slc6a20b APN 9 123597329 missense possibly damaging 0.55
IGL03115:Slc6a20b APN 9 123597338 missense possibly damaging 0.82
IGL03228:Slc6a20b APN 9 123632132 nonsense probably null
PIT4131001:Slc6a20b UTSW 9 123612126 missense probably benign 0.00
R0653:Slc6a20b UTSW 9 123597312 missense probably damaging 1.00
R1072:Slc6a20b UTSW 9 123598459 missense probably damaging 0.97
R1759:Slc6a20b UTSW 9 123608997 critical splice donor site probably null
R1889:Slc6a20b UTSW 9 123632204 missense probably benign 0.02
R2075:Slc6a20b UTSW 9 123595034 missense probably benign 0.13
R2187:Slc6a20b UTSW 9 123598588 missense probably damaging 1.00
R4097:Slc6a20b UTSW 9 123612757 utr 3 prime probably benign
R4762:Slc6a20b UTSW 9 123598560 missense probably damaging 1.00
R4834:Slc6a20b UTSW 9 123596048 missense probably benign 0.00
R4932:Slc6a20b UTSW 9 123604796 missense probably damaging 1.00
R5079:Slc6a20b UTSW 9 123598498 missense probably damaging 1.00
R5095:Slc6a20b UTSW 9 123595054 missense probably benign
R5307:Slc6a20b UTSW 9 123603834 missense possibly damaging 0.62
R6108:Slc6a20b UTSW 9 123596186 missense probably benign 0.01
R6285:Slc6a20b UTSW 9 123609096 missense possibly damaging 0.81
R6463:Slc6a20b UTSW 9 123604949 missense possibly damaging 0.62
R7050:Slc6a20b UTSW 9 123598543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCCGTTGAGGTCCAGAG -3'
(R):5'- TCTGTCCACACTGACCTGGATG -3'

Sequencing Primer
(F):5'- ATTTGGGAGTCAGAATCCAGGTCC -3'
(R):5'- ACACTGACCTGGATGCTCCTG -3'
Posted On2017-01-03