Incidental Mutation 'R5721:Lsg1'
ID451459
Institutional Source Beutler Lab
Gene Symbol Lsg1
Ensembl Gene ENSMUSG00000022538
Gene Namelarge 60S subunit nuclear export GTPase 1
SynonymsD16Bwg1547e
MMRRC Submission 043189-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R5721 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location30560494-30587592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30561775 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 615 (A615T)
Ref Sequence ENSEMBL: ENSMUSP00000112860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117363] [ENSMUST00000143170]
Predicted Effect probably benign
Transcript: ENSMUST00000117363
AA Change: A615T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112860
Gene: ENSMUSG00000022538
AA Change: A615T

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
coiled coil region 129 151 N/A INTRINSIC
SCOP:d1h65a_ 165 280 2e-3 SMART
low complexity region 300 309 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:MMR_HSR1 374 461 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150499
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the yeast large subunit GTPase 1. The encoded protein is necessary for cell viability and may localize in the endoplasmic reticulum, nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,597 V30D probably damaging Het
Atl3 T A 19: 7,529,011 M302K probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Ciz1 C T 2: 32,376,040 T39I probably damaging Het
Cog8 T C 8: 107,050,148 T532A probably benign Het
Ctsr C T 13: 61,161,853 G181S possibly damaging Het
Drc7 T C 8: 95,074,333 probably null Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Faf1 T C 4: 109,935,666 F612L probably benign Het
Fbxo40 T A 16: 36,968,934 M605L probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gprc6a A T 10: 51,614,980 M716K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Jcad A T 18: 4,676,044 T1269S possibly damaging Het
Kif23 C G 9: 61,944,216 G66A probably benign Het
Lrrd1 T C 5: 3,850,619 M308T probably benign Het
Mcph1 G A 8: 18,671,207 V684M probably damaging Het
Mpv17l T C 16: 13,946,794 Y62H probably damaging Het
Olfr270 G T 4: 52,971,068 W149L probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Osgepl1 A T 1: 53,321,200 M362L possibly damaging Het
P2ry14 T C 3: 59,115,031 probably null Het
Pacsin3 T A 2: 91,264,235 C402S probably damaging Het
Papss2 A G 19: 32,660,664 Y392C probably damaging Het
Plekha8 T A 6: 54,613,106 W19R probably damaging Het
Prdm15 A T 16: 97,807,096 I667N possibly damaging Het
Rab11fip2 A G 19: 59,935,610 S279P probably damaging Het
Slc6a20b C A 9: 123,611,989 G131C probably null Het
Suox T C 10: 128,671,293 I289V possibly damaging Het
Tbc1d16 C T 11: 119,158,730 probably null Het
Tmem269 T C 4: 119,209,949 T146A probably benign Het
Ttc30a1 A T 2: 75,981,371 Y123N probably damaging Het
Ttn G A 2: 76,728,567 R29657W probably damaging Het
Vmn1r84 C A 7: 12,362,226 C168F probably damaging Het
Zc3h7b T C 15: 81,773,298 F180L probably benign Het
Zfand4 C G 6: 116,287,995 D140E probably damaging Het
Other mutations in Lsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Lsg1 APN 16 30582095 missense probably damaging 1.00
IGL02023:Lsg1 APN 16 30585676 missense probably damaging 1.00
IGL02530:Lsg1 APN 16 30571242 missense probably benign 0.31
IGL02647:Lsg1 APN 16 30585552 critical splice donor site probably null
IGL02710:Lsg1 APN 16 30571474 missense probably benign
IGL02714:Lsg1 APN 16 30585550 splice site probably null
IGL02938:Lsg1 APN 16 30571206 missense probably benign
R1349:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1372:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1569:Lsg1 UTSW 16 30581005 synonymous probably null
R1667:Lsg1 UTSW 16 30571352 missense probably damaging 1.00
R2445:Lsg1 UTSW 16 30564695 missense probably benign 0.01
R2991:Lsg1 UTSW 16 30561729 missense probably damaging 0.97
R3611:Lsg1 UTSW 16 30561795 missense probably benign 0.04
R4256:Lsg1 UTSW 16 30573243 missense probably benign 0.01
R4700:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R4750:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R5114:Lsg1 UTSW 16 30561720 missense probably damaging 1.00
R5580:Lsg1 UTSW 16 30569167 missense probably null 0.91
R5589:Lsg1 UTSW 16 30581001 missense probably damaging 1.00
R5719:Lsg1 UTSW 16 30561775 missense probably benign 0.00
R6377:Lsg1 UTSW 16 30574568 missense possibly damaging 0.95
R6899:Lsg1 UTSW 16 30582088 missense probably benign
X0065:Lsg1 UTSW 16 30571458 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACTTCTGGTGCGACTGTG -3'
(R):5'- TCAGAAGCTATGCACAAGCG -3'

Sequencing Primer
(F):5'- TCCAGTCCACAGTGCAGTG -3'
(R):5'- CTATGCACAAGCGGAATAGTGC -3'
Posted On2017-01-03