Incidental Mutation 'R5732:Tex10'
ID451476
Institutional Source Beutler Lab
Gene Symbol Tex10
Ensembl Gene ENSMUSG00000028345
Gene Nametestis expressed gene 10
Synonymsclone 18330, 2810462N03Rik, 2610206N19Rik
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location48430858-48473459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 48460046 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 435 (T435K)
Ref Sequence ENSEMBL: ENSMUSP00000132498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030030] [ENSMUST00000155905] [ENSMUST00000164866]
Predicted Effect probably damaging
Transcript: ENSMUST00000030030
AA Change: T435K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030030
Gene: ENSMUSG00000028345
AA Change: T435K

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 130 235 9.7e-24 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138531
Predicted Effect probably benign
Transcript: ENSMUST00000155905
SMART Domains Protein: ENSMUSP00000114669
Gene: ENSMUSG00000028345

DomainStartEndE-ValueType
Pfam:Ipi1_N 47 152 3.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164866
AA Change: T435K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132498
Gene: ENSMUSG00000028345
AA Change: T435K

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 132 235 4.1e-25 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E7.5 with impaired inner cell mass proliferation in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Tex10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tex10 APN 4 48469937 nonsense probably null
IGL00832:Tex10 APN 4 48468864 missense probably benign
IGL01376:Tex10 APN 4 48456740 missense possibly damaging 0.90
IGL01594:Tex10 APN 4 48469906 missense possibly damaging 0.47
IGL02754:Tex10 APN 4 48435028 missense possibly damaging 0.46
IGL03071:Tex10 APN 4 48452946 missense probably benign 0.00
IGL03399:Tex10 APN 4 48459915 missense probably benign 0.04
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0544:Tex10 UTSW 4 48462766 splice site probably null
R0583:Tex10 UTSW 4 48451952 missense probably damaging 1.00
R0591:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0592:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0593:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0893:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1485:Tex10 UTSW 4 48436492 missense possibly damaging 0.54
R1703:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1704:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1706:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1911:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1912:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1930:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1983:Tex10 UTSW 4 48460059 missense possibly damaging 0.93
R2001:Tex10 UTSW 4 48451940 missense probably damaging 1.00
R2074:Tex10 UTSW 4 48456800 missense probably benign 0.04
R2075:Tex10 UTSW 4 48456800 missense probably benign 0.04
R2157:Tex10 UTSW 4 48436522 splice site probably benign
R3000:Tex10 UTSW 4 48459393 splice site probably null
R4067:Tex10 UTSW 4 48459355 nonsense probably null
R4081:Tex10 UTSW 4 48468873 missense probably benign 0.11
R4133:Tex10 UTSW 4 48468968 missense probably damaging 1.00
R4352:Tex10 UTSW 4 48452039 missense possibly damaging 0.77
R4364:Tex10 UTSW 4 48468774 missense probably benign 0.13
R4601:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4602:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4610:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4707:Tex10 UTSW 4 48468984 missense probably benign 0.00
R4744:Tex10 UTSW 4 48469990 missense probably benign 0.00
R4778:Tex10 UTSW 4 48436468 missense probably damaging 1.00
R4989:Tex10 UTSW 4 48458525 splice site probably benign
R5051:Tex10 UTSW 4 48460019 missense possibly damaging 0.86
R5120:Tex10 UTSW 4 48459272 missense possibly damaging 0.68
R5799:Tex10 UTSW 4 48433295 missense possibly damaging 0.62
R5813:Tex10 UTSW 4 48452928 missense probably benign 0.00
R6091:Tex10 UTSW 4 48459891 missense probably damaging 0.98
R6223:Tex10 UTSW 4 48468525 missense probably damaging 0.98
R6493:Tex10 UTSW 4 48436450 missense probably damaging 1.00
R7567:Tex10 UTSW 4 48468787 missense possibly damaging 0.93
X0017:Tex10 UTSW 4 48460080 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCAGACCCAGATCTTCTC -3'
(R):5'- TGCCTAGTACTCTGTCAGCTTGG -3'

Sequencing Primer
(F):5'- GCACCACCTACCTCTGTTTGG -3'
(R):5'- AGTGCTCAAAAGCAGGTG -3'
Posted On2017-01-03