Incidental Mutation 'R5732:Acaa1b'
ID451499
Institutional Source Beutler Lab
Gene Symbol Acaa1b
Ensembl Gene ENSMUSG00000010651
Gene Nameacetyl-Coenzyme A acyltransferase 1B
Synonymsthiolase B
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119148023-119157093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119148394 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 407 (M407L)
Ref Sequence ENSEMBL: ENSMUSP00000010795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010795] [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010795
AA Change: M407L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000010795
Gene: ENSMUSG00000010651
AA Change: M407L

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 6.7e-90 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137047
Predicted Effect probably benign
Transcript: ENSMUST00000140326
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165231
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Acaa1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03012:Acaa1b APN 9 119156946 missense probably benign 0.00
R0330:Acaa1b UTSW 9 119153970 missense probably damaging 1.00
R1036:Acaa1b UTSW 9 119150816 unclassified probably benign
R1916:Acaa1b UTSW 9 119156662 missense probably damaging 1.00
R3716:Acaa1b UTSW 9 119156641 missense probably benign 0.06
R4805:Acaa1b UTSW 9 119156946 missense probably benign 0.00
R5535:Acaa1b UTSW 9 119148406 missense probably damaging 1.00
R6883:Acaa1b UTSW 9 119156660 missense possibly damaging 0.86
R7298:Acaa1b UTSW 9 119151847 missense probably benign
R7330:Acaa1b UTSW 9 119148382 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGAGAACCGGATTGGATGCC -3'
(R):5'- TAACCAGGTACCTGTCACCC -3'

Sequencing Primer
(F):5'- ACGTGTACCCATGCTGCAATTAC -3'
(R):5'- TCACCCGGGTGTGTGTC -3'
Posted On2017-01-03