Incidental Mutation 'R0551:Clca4b'
ID45150
Institutional Source Beutler Lab
Gene Symbol Clca4b
Ensembl Gene ENSMUSG00000074195
Gene Namechloride channel accessory 4B
SynonymsAI747448
MMRRC Submission 038743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0551 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144910921-144932529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144928626 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 69 (T69S)
Ref Sequence ENSEMBL: ENSMUSP00000096149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098549]
Predicted Effect probably damaging
Transcript: ENSMUST00000098549
AA Change: T69S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096149
Gene: ENSMUSG00000074195
AA Change: T69S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 306 480 1.03e-15 SMART
Blast:VWA 513 552 6e-16 BLAST
Blast:FN3 757 838 5e-35 BLAST
low complexity region 882 906 N/A INTRINSIC
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: No notable phenotype was detected in a high throughput screen of homozyogus mutant null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Auts2 T C 5: 131,440,469 E446G possibly damaging Het
Brwd1 C T 16: 96,035,974 R886H probably damaging Het
Carm1 G A 9: 21,580,491 probably null Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Cpox A G 16: 58,675,390 I357V probably benign Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Ganab T G 19: 8,907,280 I149S probably benign Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Klkb1 A G 8: 45,277,966 probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Manba T C 3: 135,517,973 I207T probably damaging Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd4a G A 1: 132,041,919 T348I probably damaging Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tiam2 T A 17: 3,428,954 M654K probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Clca4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Clca4b APN 3 144932391 missense probably benign 0.00
IGL00391:Clca4b APN 3 144915561 missense possibly damaging 0.81
IGL00576:Clca4b APN 3 144925347 missense probably damaging 1.00
IGL01484:Clca4b APN 3 144928235 missense probably benign 0.02
IGL01539:Clca4b APN 3 144926157 missense probably benign
IGL01726:Clca4b APN 3 144928342 missense probably damaging 1.00
IGL01903:Clca4b APN 3 144928259 missense probably damaging 0.98
IGL01967:Clca4b APN 3 144928190 splice site probably benign
IGL02002:Clca4b APN 3 144932433 missense probably benign 0.00
IGL02323:Clca4b APN 3 144913321 missense probably benign
IGL02379:Clca4b APN 3 144921858 missense probably benign 0.00
IGL02638:Clca4b APN 3 144926178 missense probably damaging 1.00
IGL02859:Clca4b APN 3 144912039 missense probably benign
R0110:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0266:Clca4b UTSW 3 144922786 missense probably damaging 1.00
R0311:Clca4b UTSW 3 144932496 missense probably benign 0.04
R0348:Clca4b UTSW 3 144921980 missense probably damaging 0.96
R0450:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0510:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0538:Clca4b UTSW 3 144921956 missense probably benign 0.15
R0552:Clca4b UTSW 3 144916775 missense probably benign
R0570:Clca4b UTSW 3 144925349 missense probably benign 0.01
R0591:Clca4b UTSW 3 144915592 nonsense probably null
R0627:Clca4b UTSW 3 144928259 missense probably benign 0.20
R0729:Clca4b UTSW 3 144928350 splice site probably benign
R0844:Clca4b UTSW 3 144916771 missense probably damaging 0.96
R0964:Clca4b UTSW 3 144915576 missense probably benign
R1388:Clca4b UTSW 3 144916654 missense probably benign
R1479:Clca4b UTSW 3 144915468 missense probably damaging 0.99
R1603:Clca4b UTSW 3 144922019 missense probably benign 0.20
R2045:Clca4b UTSW 3 144925163 missense probably damaging 1.00
R2162:Clca4b UTSW 3 144928587 missense probably benign 0.19
R2185:Clca4b UTSW 3 144928556 missense probably damaging 1.00
R2241:Clca4b UTSW 3 144911226 missense probably benign 0.00
R2300:Clca4b UTSW 3 144916671 missense probably benign 0.02
R2321:Clca4b UTSW 3 144932373 missense probably benign 0.00
R2359:Clca4b UTSW 3 144925242 missense probably damaging 0.96
R3105:Clca4b UTSW 3 144916671 missense probably benign 0.02
R3151:Clca4b UTSW 3 144915511 missense probably benign 0.05
R3158:Clca4b UTSW 3 144912117 missense probably benign 0.04
R3177:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3277:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3981:Clca4b UTSW 3 144926036 missense probably benign 0.27
R4601:Clca4b UTSW 3 144927184 missense possibly damaging 0.81
R4646:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4647:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4696:Clca4b UTSW 3 144911385 missense probably benign 0.00
R4893:Clca4b UTSW 3 144925173 missense possibly damaging 0.67
R4998:Clca4b UTSW 3 144915508 missense probably benign 0.00
R5053:Clca4b UTSW 3 144911121 missense probably benign 0.01
R5060:Clca4b UTSW 3 144911506 missense probably damaging 1.00
R5319:Clca4b UTSW 3 144925179 missense possibly damaging 0.85
R5409:Clca4b UTSW 3 144916691 nonsense probably null
R5534:Clca4b UTSW 3 144915466 missense probably damaging 1.00
R5578:Clca4b UTSW 3 144932435 missense probably benign 0.04
R5667:Clca4b UTSW 3 144921863 missense probably benign
R5671:Clca4b UTSW 3 144921863 missense probably benign
R5715:Clca4b UTSW 3 144913257 missense probably benign 0.01
R5875:Clca4b UTSW 3 144922889 missense probably benign 0.38
R5876:Clca4b UTSW 3 144912060 missense possibly damaging 0.91
R6122:Clca4b UTSW 3 144926166 missense possibly damaging 0.67
R6294:Clca4b UTSW 3 144925185 missense probably null
R6408:Clca4b UTSW 3 144919275 missense probably benign 0.00
R6418:Clca4b UTSW 3 144928235 missense probably benign 0.02
R6458:Clca4b UTSW 3 144911327 missense possibly damaging 0.77
R6536:Clca4b UTSW 3 144916729 missense possibly damaging 0.66
R6567:Clca4b UTSW 3 144932339 missense possibly damaging 0.96
R6781:Clca4b UTSW 3 144922801 missense probably benign
R6799:Clca4b UTSW 3 144915627 splice site probably null
R7046:Clca4b UTSW 3 144915606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCGGGAGGTGCCACTTTAATG -3'
(R):5'- GCCTGCTGAGGAATGAGCTTGATG -3'

Sequencing Primer
(F):5'- AGGTGCCACTTTAATGTCAGC -3'
(R):5'- AGCTTGATGCATGGCTCC -3'
Posted On2013-06-11