Incidental Mutation 'R5733:Itgax'
ID 451540
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Name integrin alpha X
Synonyms CD11C (p150) alpha polypeptide, CR4, Cd11c
MMRRC Submission 043193-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R5733 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127728719-127749829 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127739647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 686 (S686R)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
AlphaFold Q9QXH4
Predicted Effect probably damaging
Transcript: ENSMUST00000033053
AA Change: S686R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: S686R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205408
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T A 5: 35,762,543 (GRCm39) probably null Het
Ahnak2 A T 12: 112,742,100 (GRCm39) Y657* probably null Het
Anxa3 T A 5: 96,968,331 (GRCm39) I128N probably damaging Het
Bsnd T C 4: 106,345,198 (GRCm39) T83A probably benign Het
Capn10 A G 1: 92,871,635 (GRCm39) Y411C probably benign Het
Capn3 G A 2: 120,315,075 (GRCm39) W201* probably null Het
Crtap T C 9: 114,207,164 (GRCm39) T365A probably benign Het
Daam1 A G 12: 71,992,272 (GRCm39) D329G unknown Het
Dmxl2 A T 9: 54,283,550 (GRCm39) L2761Q possibly damaging Het
Fcho2 A C 13: 98,926,310 (GRCm39) V91G probably damaging Het
Fen1 A T 19: 10,178,022 (GRCm39) C141S possibly damaging Het
Fkbp15 G C 4: 62,225,166 (GRCm39) A831G probably benign Het
Frmd4a A T 2: 4,305,768 (GRCm39) R14S possibly damaging Het
Fzr1 A G 10: 81,206,160 (GRCm39) F176L possibly damaging Het
Garem2 A G 5: 30,321,336 (GRCm39) D565G probably damaging Het
Garre1 A T 7: 33,944,505 (GRCm39) S76T probably damaging Het
Iqca1 G T 1: 89,998,257 (GRCm39) T549K probably damaging Het
Knop1 C A 7: 118,445,305 (GRCm39) G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 (GRCm39) C49S probably damaging Het
Mpzl1 A T 1: 165,433,180 (GRCm39) I157K probably benign Het
Mrgprb2 T C 7: 48,202,261 (GRCm39) I155V probably benign Het
Mucl3 T C 17: 35,949,102 (GRCm39) M166V probably benign Het
Mvb12b T C 2: 33,717,728 (GRCm39) T167A probably benign Het
Myh3 A G 11: 66,979,445 (GRCm39) N491S probably benign Het
Myo5b A G 18: 74,787,128 (GRCm39) D511G possibly damaging Het
Or10ak8 C T 4: 118,774,035 (GRCm39) V210I probably benign Het
Or11h4 T C 14: 50,974,509 (GRCm39) T37A probably benign Het
Or6b1 C T 6: 42,815,180 (GRCm39) R122C probably damaging Het
Or8k21 T G 2: 86,145,558 (GRCm39) Q24P probably damaging Het
Ptcd1 A G 5: 145,091,671 (GRCm39) M476T probably damaging Het
Pum3 A G 19: 27,398,695 (GRCm39) probably null Het
Ranbp2 G A 10: 58,321,658 (GRCm39) D2652N probably damaging Het
Rassf1 T C 9: 107,435,213 (GRCm39) V166A probably damaging Het
Rictor A G 15: 6,812,585 (GRCm39) H907R probably benign Het
Rorb T C 19: 18,965,471 (GRCm39) E6G probably damaging Het
Serpina3f A T 12: 104,183,182 (GRCm39) T15S possibly damaging Het
Sorbs2 T C 8: 46,212,226 (GRCm39) L100P probably damaging Het
Sprr2k T C 3: 92,340,655 (GRCm39) probably benign Het
Srrm2 T A 17: 24,040,360 (GRCm39) S2431T probably damaging Het
Stox2 T A 8: 47,866,172 (GRCm39) K57* probably null Het
Ttc21a G A 9: 119,770,327 (GRCm39) V133I probably benign Het
Vasn T C 16: 4,468,026 (GRCm39) Y658H possibly damaging Het
Zfp251 A G 15: 76,754,527 (GRCm39) Y35H probably damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 127,734,498 (GRCm39) missense probably damaging 1.00
IGL00325:Itgax APN 7 127,747,481 (GRCm39) missense possibly damaging 0.69
IGL01155:Itgax APN 7 127,744,207 (GRCm39) missense probably benign 0.00
IGL01461:Itgax APN 7 127,734,190 (GRCm39) missense probably damaging 1.00
IGL01508:Itgax APN 7 127,743,990 (GRCm39) missense probably damaging 1.00
IGL01549:Itgax APN 7 127,730,378 (GRCm39) splice site probably null
IGL01864:Itgax APN 7 127,732,935 (GRCm39) missense probably benign 0.00
IGL02094:Itgax APN 7 127,730,645 (GRCm39) missense probably damaging 1.00
IGL02364:Itgax APN 7 127,739,154 (GRCm39) missense possibly damaging 0.89
IGL02969:Itgax APN 7 127,748,295 (GRCm39) missense probably benign
IGL03406:Itgax APN 7 127,748,370 (GRCm39) missense possibly damaging 0.93
Adendritic UTSW 7 127,747,744 (GRCm39) nonsense probably null
PIT4651001:Itgax UTSW 7 127,748,282 (GRCm39) missense probably benign 0.11
R0366:Itgax UTSW 7 127,748,261 (GRCm39) splice site probably benign
R0763:Itgax UTSW 7 127,747,112 (GRCm39) splice site probably benign
R1072:Itgax UTSW 7 127,749,316 (GRCm39) missense probably damaging 0.96
R1659:Itgax UTSW 7 127,730,063 (GRCm39) missense probably benign 0.15
R2019:Itgax UTSW 7 127,747,698 (GRCm39) missense probably benign
R2418:Itgax UTSW 7 127,741,505 (GRCm39) missense probably damaging 0.98
R3027:Itgax UTSW 7 127,747,744 (GRCm39) nonsense probably null
R3846:Itgax UTSW 7 127,732,939 (GRCm39) missense probably damaging 1.00
R3938:Itgax UTSW 7 127,735,445 (GRCm39) missense possibly damaging 0.73
R4021:Itgax UTSW 7 127,732,311 (GRCm39) critical splice donor site probably null
R4027:Itgax UTSW 7 127,740,438 (GRCm39) missense possibly damaging 0.75
R4163:Itgax UTSW 7 127,743,872 (GRCm39) missense probably benign 0.00
R4923:Itgax UTSW 7 127,747,700 (GRCm39) missense probably benign
R5259:Itgax UTSW 7 127,747,450 (GRCm39) missense probably damaging 0.99
R5333:Itgax UTSW 7 127,741,455 (GRCm39) missense probably damaging 1.00
R5347:Itgax UTSW 7 127,740,474 (GRCm39) missense probably benign 0.08
R5679:Itgax UTSW 7 127,734,162 (GRCm39) missense probably benign 0.00
R5725:Itgax UTSW 7 127,747,033 (GRCm39) missense possibly damaging 0.63
R5750:Itgax UTSW 7 127,743,878 (GRCm39) missense probably benign 0.32
R5964:Itgax UTSW 7 127,739,619 (GRCm39) missense probably damaging 1.00
R6004:Itgax UTSW 7 127,730,624 (GRCm39) missense probably damaging 0.96
R6168:Itgax UTSW 7 127,732,269 (GRCm39) missense probably damaging 0.99
R6212:Itgax UTSW 7 127,747,025 (GRCm39) missense probably benign 0.16
R6212:Itgax UTSW 7 127,729,504 (GRCm39) missense possibly damaging 0.52
R6480:Itgax UTSW 7 127,747,771 (GRCm39) missense probably benign 0.12
R6484:Itgax UTSW 7 127,732,890 (GRCm39) missense probably benign 0.13
R6796:Itgax UTSW 7 127,734,236 (GRCm39) missense probably damaging 1.00
R6844:Itgax UTSW 7 127,747,106 (GRCm39) splice site probably null
R7287:Itgax UTSW 7 127,747,677 (GRCm39) missense probably damaging 1.00
R7365:Itgax UTSW 7 127,734,481 (GRCm39) missense probably damaging 1.00
R7421:Itgax UTSW 7 127,739,604 (GRCm39) missense probably damaging 1.00
R7599:Itgax UTSW 7 127,747,262 (GRCm39) missense probably damaging 0.99
R7710:Itgax UTSW 7 127,735,028 (GRCm39) missense probably benign 0.04
R7964:Itgax UTSW 7 127,739,590 (GRCm39) critical splice acceptor site probably null
R8220:Itgax UTSW 7 127,730,090 (GRCm39) missense probably benign 0.00
R8730:Itgax UTSW 7 127,739,066 (GRCm39) critical splice acceptor site probably null
R8742:Itgax UTSW 7 127,743,795 (GRCm39) missense probably benign 0.28
R8812:Itgax UTSW 7 127,732,979 (GRCm39) missense probably damaging 1.00
R8871:Itgax UTSW 7 127,735,223 (GRCm39) missense probably damaging 1.00
R9147:Itgax UTSW 7 127,747,913 (GRCm39) missense possibly damaging 0.74
R9149:Itgax UTSW 7 127,730,641 (GRCm39) missense probably benign 0.01
R9310:Itgax UTSW 7 127,741,432 (GRCm39) nonsense probably null
R9376:Itgax UTSW 7 127,747,935 (GRCm39) missense possibly damaging 0.94
R9377:Itgax UTSW 7 127,732,849 (GRCm39) missense probably benign 0.03
R9641:Itgax UTSW 7 127,741,152 (GRCm39) missense probably damaging 1.00
R9650:Itgax UTSW 7 127,734,935 (GRCm39) missense probably benign 0.24
R9709:Itgax UTSW 7 127,735,500 (GRCm39) missense probably damaging 1.00
X0061:Itgax UTSW 7 127,728,779 (GRCm39) start gained probably benign
Z1176:Itgax UTSW 7 127,744,044 (GRCm39) missense probably benign 0.24
Z1177:Itgax UTSW 7 127,747,234 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAAGACCCAACTAGGTGAGTCTC -3'
(R):5'- CCAGATCTGGGGCTAAAGGTAG -3'

Sequencing Primer
(F):5'- CTTCCTTTTGATCTGACCTTGGGAAG -3'
(R):5'- GAAAGCTCAGAACATGCTGTG -3'
Posted On 2017-01-03