Incidental Mutation 'R5733:Fcho2'
ID451552
Institutional Source Beutler Lab
Gene Symbol Fcho2
Ensembl Gene ENSMUSG00000041685
Gene NameFCH domain only 2
Synonyms
MMRRC Submission 043193-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5733 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location98723403-98815449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98789802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 91 (V91G)
Ref Sequence ENSEMBL: ENSMUSP00000096883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040340] [ENSMUST00000099277] [ENSMUST00000109403] [ENSMUST00000179563] [ENSMUST00000224992] [ENSMUST00000225840]
Predicted Effect probably damaging
Transcript: ENSMUST00000040340
AA Change: V91G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042959
Gene: ENSMUSG00000041685
AA Change: V91G

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
low complexity region 503 520 N/A INTRINSIC
Pfam:muHD 542 808 2.5e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099277
AA Change: V91G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096883
Gene: ENSMUSG00000041685
AA Change: V91G

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 342 352 N/A INTRINSIC
low complexity region 434 457 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 504 521 N/A INTRINSIC
Pfam:muHD 543 803 4.7e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109403
AA Change: V91G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105030
Gene: ENSMUSG00000041685
AA Change: V91G

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179563
AA Change: V91G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137422
Gene: ENSMUSG00000041685
AA Change: V91G

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224231
Predicted Effect probably damaging
Transcript: ENSMUST00000224992
AA Change: V91G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225094
Predicted Effect possibly damaging
Transcript: ENSMUST00000225840
AA Change: V91G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,245,080 S76T probably damaging Het
Acox3 T A 5: 35,605,199 probably null Het
Ahnak2 A T 12: 112,775,666 Y657* probably null Het
Anxa3 T A 5: 96,820,472 I128N probably damaging Het
Bsnd T C 4: 106,488,001 T83A probably benign Het
Capn10 A G 1: 92,943,913 Y411C probably benign Het
Capn3 G A 2: 120,484,594 W201* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
Daam1 A G 12: 71,945,498 D329G unknown Het
Dmxl2 A T 9: 54,376,266 L2761Q possibly damaging Het
Dpcr1 T C 17: 35,638,210 M166V probably benign Het
Fen1 A T 19: 10,200,658 C141S possibly damaging Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Frmd4a A T 2: 4,300,957 R14S possibly damaging Het
Fzr1 A G 10: 81,370,326 F176L possibly damaging Het
Garem2 A G 5: 30,116,338 D565G probably damaging Het
Iqca G T 1: 90,070,535 T549K probably damaging Het
Itgax T A 7: 128,140,475 S686R probably damaging Het
Knop1 C A 7: 118,846,082 G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 C49S probably damaging Het
Mpzl1 A T 1: 165,605,611 I157K probably benign Het
Mrgprb2 T C 7: 48,552,513 I155V probably benign Het
Mvb12b T C 2: 33,827,716 T167A probably benign Het
Myh3 A G 11: 67,088,619 N491S probably benign Het
Myo5b A G 18: 74,654,057 D511G possibly damaging Het
Olfr1053 T G 2: 86,315,214 Q24P probably damaging Het
Olfr1329 C T 4: 118,916,838 V210I probably benign Het
Olfr449 C T 6: 42,838,246 R122C probably damaging Het
Olfr749 T C 14: 50,737,052 T37A probably benign Het
Ptcd1 A G 5: 145,154,861 M476T probably damaging Het
Pum3 A G 19: 27,421,295 probably null Het
Ranbp2 G A 10: 58,485,836 D2652N probably damaging Het
Rassf1 T C 9: 107,558,014 V166A probably damaging Het
Rictor A G 15: 6,783,104 H907R probably benign Het
Rorb T C 19: 18,988,107 E6G probably damaging Het
Serpina3f A T 12: 104,216,923 T15S possibly damaging Het
Sorbs2 T C 8: 45,759,189 L100P probably damaging Het
Sprr2k T C 3: 92,433,348 probably benign Het
Srrm2 T A 17: 23,821,386 S2431T probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Ttc21a G A 9: 119,941,261 V133I probably benign Het
Vasn T C 16: 4,650,162 Y658H possibly damaging Het
Zfp251 A G 15: 76,870,327 Y35H probably damaging Het
Other mutations in Fcho2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fcho2 APN 13 98789807 missense probably benign
IGL02058:Fcho2 APN 13 98730906 missense probably damaging 0.98
IGL02516:Fcho2 APN 13 98730212 missense probably benign 0.08
IGL02715:Fcho2 APN 13 98796335 missense probably damaging 1.00
IGL03243:Fcho2 APN 13 98777384 splice site probably benign
R0044:Fcho2 UTSW 13 98755544 intron probably benign
R0087:Fcho2 UTSW 13 98735086 missense probably benign 0.00
R0472:Fcho2 UTSW 13 98748267 missense probably benign 0.01
R0501:Fcho2 UTSW 13 98764515 missense possibly damaging 0.92
R1022:Fcho2 UTSW 13 98732659 missense probably damaging 1.00
R1024:Fcho2 UTSW 13 98732659 missense probably damaging 1.00
R1130:Fcho2 UTSW 13 98748289 missense probably damaging 1.00
R1495:Fcho2 UTSW 13 98749850 critical splice donor site probably null
R1593:Fcho2 UTSW 13 98784807 missense possibly damaging 0.92
R1608:Fcho2 UTSW 13 98726198 missense probably benign 0.01
R1638:Fcho2 UTSW 13 98745895 missense possibly damaging 0.83
R1643:Fcho2 UTSW 13 98784816 missense probably benign 0.00
R2125:Fcho2 UTSW 13 98775898 missense possibly damaging 0.83
R3117:Fcho2 UTSW 13 98777438 missense probably damaging 1.00
R3968:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R3970:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R4079:Fcho2 UTSW 13 98755612 missense probably damaging 0.99
R4816:Fcho2 UTSW 13 98806366 missense probably damaging 1.00
R5338:Fcho2 UTSW 13 98730891 missense probably damaging 1.00
R5437:Fcho2 UTSW 13 98777474 missense possibly damaging 0.95
R5457:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R6136:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R6186:Fcho2 UTSW 13 98815083 missense probably benign 0.01
R6365:Fcho2 UTSW 13 98789859 missense probably benign 0.20
R7041:Fcho2 UTSW 13 98784826 missense possibly damaging 0.72
R7168:Fcho2 UTSW 13 98789463 missense probably benign
R7218:Fcho2 UTSW 13 98753613 intron probably null
R7243:Fcho2 UTSW 13 98755216 missense possibly damaging 0.94
R7533:Fcho2 UTSW 13 98784799 missense not run
X0018:Fcho2 UTSW 13 98732082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAATGGCTTGGACTGCTTC -3'
(R):5'- CGGCAAGTTTTGTGTCCCTATAG -3'

Sequencing Primer
(F):5'- GACTGCTTCCAGAGTCCCTG -3'
(R):5'- TCCCAAAGAAAATTGCTGAATAGAG -3'
Posted On2017-01-03