Incidental Mutation 'R5734:Selp'
ID451568
Institutional Source Beutler Lab
Gene Symbol Selp
Ensembl Gene ENSMUSG00000026580
Gene Nameselectin, platelet
SynonymsGrmp, CD62P, P-selectin
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164115264-164150026 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 164143891 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162746]
PDB Structure
Structure of the SNX17 atypical FERM domain bound to the NPxY motif of P-selectin [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161020
Predicted Effect probably benign
Transcript: ENSMUST00000161152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162102
Predicted Effect probably benign
Transcript: ENSMUST00000162746
SMART Domains Protein: ENSMUSP00000123924
Gene: ENSMUSG00000026580

DomainStartEndE-ValueType
CLECT 30 159 2.89e-16 SMART
EGF 162 195 1.97e-4 SMART
CCP 200 257 1.31e-14 SMART
CCP 262 319 4.02e-15 SMART
CCP 324 381 5.91e-13 SMART
CCP 386 443 1.46e-12 SMART
CCP 448 505 3.9e-13 SMART
CCP 510 567 1.95e-13 SMART
CCP 580 637 1.97e-9 SMART
CCP 642 699 3.9e-13 SMART
transmembrane domain 711 733 N/A INTRINSIC
PDB:4GXB|B 741 768 2e-12 PDB
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 140 kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interaction of activated endothelial cells or platelets with leukocytes. The membrane protein is a calcium-dependent receptor that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. Alternative splice variants may occur but are not well documented. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mildly attenuated inflammatory responses, increased numbers of circulating neutrophils, lack of leukocyte rolling in mesenteric venules, and increased survival after Plasmodium berghei infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Selp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Selp APN 1 164143892 critical splice acceptor site probably null
IGL02430:Selp APN 1 164126383 missense probably damaging 1.00
IGL02591:Selp APN 1 164130133 missense probably damaging 1.00
IGL02883:Selp APN 1 164130102 missense probably benign 0.00
IGL02945:Selp APN 1 164133929 missense probably damaging 1.00
PIT4812001:Selp UTSW 1 164132263 missense probably benign 0.29
R1571:Selp UTSW 1 164126607 missense probably damaging 1.00
R1731:Selp UTSW 1 164141440 nonsense probably null
R1758:Selp UTSW 1 164132285 missense possibly damaging 0.64
R1834:Selp UTSW 1 164128160 splice site probably null
R1951:Selp UTSW 1 164126512 missense probably benign 0.36
R1953:Selp UTSW 1 164126512 missense probably benign 0.36
R1987:Selp UTSW 1 164142758 missense probably damaging 0.98
R2244:Selp UTSW 1 164137286 nonsense probably null
R2484:Selp UTSW 1 164143954 missense probably benign 0.43
R2484:Selp UTSW 1 164143955 missense probably damaging 1.00
R3440:Selp UTSW 1 164123775 missense probably benign 0.17
R3831:Selp UTSW 1 164132280 nonsense probably null
R3958:Selp UTSW 1 164126286 missense probably benign 0.03
R4795:Selp UTSW 1 164144906 missense probably benign 0.15
R4796:Selp UTSW 1 164144906 missense probably benign 0.15
R4807:Selp UTSW 1 164143936 missense probably damaging 1.00
R4832:Selp UTSW 1 164126340 missense probably damaging 1.00
R4917:Selp UTSW 1 164144906 missense probably damaging 0.99
R4921:Selp UTSW 1 164141397 missense possibly damaging 0.93
R5399:Selp UTSW 1 164126586 missense possibly damaging 0.93
R5752:Selp UTSW 1 164137242 missense probably damaging 1.00
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6185:Selp UTSW 1 164126346 missense probably damaging 1.00
R6555:Selp UTSW 1 164141602 intron probably null
R6955:Selp UTSW 1 164144909 missense possibly damaging 0.94
R7106:Selp UTSW 1 164126422 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTGATTCCATGGGCCATCC -3'
(R):5'- CATGGCATCTGACCAGTGAC -3'

Sequencing Primer
(F):5'- TATTCCAGTGGAGGCTTCAGCAAG -3'
(R):5'- ATCTGACCAGTGACCGTCC -3'
Posted On2017-01-03