Incidental Mutation 'R5734:Pabpc4l'
ID451576
Institutional Source Beutler Lab
Gene Symbol Pabpc4l
Ensembl Gene ENSMUSG00000090919
Gene Namepoly(A) binding protein, cytoplasmic 4-like
SynonymsEG241989, C330050A14Rik
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location46442197-46448219 bp(-) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) T to A at 46446689 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166505] [ENSMUST00000192793] [ENSMUST00000195436] [ENSMUST00000195537]
Predicted Effect probably damaging
Transcript: ENSMUST00000166505
AA Change: K173N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126224
Gene: ENSMUSG00000090919
AA Change: K173N

DomainStartEndE-ValueType
RRM 11 84 3.4e-17 SMART
RRM 99 170 4.22e-22 SMART
RRM 191 263 2.44e-27 SMART
RRM 294 365 7.24e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192793
AA Change: K173N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141300
Gene: ENSMUSG00000090919
AA Change: K173N

DomainStartEndE-ValueType
RRM 11 84 3.4e-17 SMART
RRM 99 170 4.22e-22 SMART
RRM 191 263 2.44e-27 SMART
RRM 294 365 7.24e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195436
SMART Domains Protein: ENSMUSP00000141684
Gene: ENSMUSG00000090919

DomainStartEndE-ValueType
RRM 11 84 1.5e-19 SMART
RRM 99 170 1.8e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195537
SMART Domains Protein: ENSMUSP00000141854
Gene: ENSMUSG00000090919

DomainStartEndE-ValueType
Pfam:RRM_1 12 51 8.9e-9 PFAM
Meta Mutation Damage Score 0.6124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Pabpc4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Pabpc4l APN 3 46447072 missense possibly damaging 0.80
IGL01594:Pabpc4l APN 3 46447146 missense probably damaging 1.00
IGL01727:Pabpc4l APN 3 46446665 missense probably damaging 1.00
IGL02937:Pabpc4l APN 3 46446290 missense probably benign 0.04
IGL02985:Pabpc4l APN 3 46446582 missense possibly damaging 0.52
IGL03393:Pabpc4l APN 3 46446537 missense probably damaging 0.98
R0734:Pabpc4l UTSW 3 46446973 missense possibly damaging 0.71
R1889:Pabpc4l UTSW 3 46446363 missense probably benign 0.00
R1928:Pabpc4l UTSW 3 46446631 missense probably damaging 1.00
R2118:Pabpc4l UTSW 3 46446841 missense probably benign 0.00
R2119:Pabpc4l UTSW 3 46446841 missense probably benign 0.00
R2124:Pabpc4l UTSW 3 46446841 missense probably benign 0.00
R2238:Pabpc4l UTSW 3 46446702 missense probably damaging 1.00
R4740:Pabpc4l UTSW 3 46446135 missense possibly damaging 0.95
R4740:Pabpc4l UTSW 3 46446144 missense probably benign 0.03
R4897:Pabpc4l UTSW 3 46447143 missense probably damaging 1.00
R4911:Pabpc4l UTSW 3 46446162 missense possibly damaging 0.88
R5310:Pabpc4l UTSW 3 46446841 missense probably benign 0.00
R5532:Pabpc4l UTSW 3 46446609 missense probably benign 0.01
R6200:Pabpc4l UTSW 3 46446703 missense probably damaging 1.00
R6994:Pabpc4l UTSW 3 46446910 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAAATCGTCTGCCCGTTTATG -3'
(R):5'- ACACTTCTCACCTTTTGGAACG -3'

Sequencing Primer
(F):5'- CTCGTGGCTATCAAAACTCAC -3'
(R):5'- CGATCATGTCTTCCAAGGTGATGAC -3'
Posted On2017-01-03