Incidental Mutation 'R5734:Zfp382'
ID451587
Institutional Source Beutler Lab
Gene Symbol Zfp382
Ensembl Gene ENSMUSG00000074220
Gene Namezinc finger protein 382
Synonyms5930415A09Rik
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30121942-30134950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30134430 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 502 (F502S)
Ref Sequence ENSEMBL: ENSMUSP00000096196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098596] [ENSMUST00000153792]
Predicted Effect probably damaging
Transcript: ENSMUST00000098596
AA Change: F502S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096196
Gene: ENSMUSG00000074220
AA Change: F502S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 42 102 3.36e-39 SMART
ZnF_C2H2 325 347 1.84e-4 SMART
ZnF_C2H2 353 375 7.26e-3 SMART
ZnF_C2H2 381 403 2.71e-2 SMART
ZnF_C2H2 409 431 4.47e-3 SMART
ZnF_C2H2 437 459 2.12e-4 SMART
ZnF_C2H2 465 487 3.95e-4 SMART
ZnF_C2H2 493 515 1.12e-3 SMART
ZnF_C2H2 521 543 2.57e-3 SMART
ZnF_C2H2 549 571 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153792
SMART Domains Protein: ENSMUSP00000123508
Gene: ENSMUSG00000074220

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156543
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a KRAB domain zinc finger transcription factor (KZNF). KZNFs play critical roles in the regulation of many cellular processes including differentiation, proliferation and apoptosis. The encoded protein inhibits activating protein 1 (AP-1) and nuclear factor kappa-B (NF-kB) signaling and may function as a tumor suppressor in multiple carcinomas. This gene is found in a cluster with other zinc finger protein genes on the long arm of chromosome 19, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Other mutations in Zfp382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Zfp382 APN 7 30133737 missense probably benign 0.00
IGL03116:Zfp382 APN 7 30134189 missense probably damaging 1.00
R1051:Zfp382 UTSW 7 30134010 missense probably damaging 1.00
R1371:Zfp382 UTSW 7 30133689 missense probably benign 0.36
R1513:Zfp382 UTSW 7 30133296 missense probably benign 0.04
R1525:Zfp382 UTSW 7 30133719 missense probably damaging 0.99
R2416:Zfp382 UTSW 7 30134403 missense probably damaging 1.00
R2432:Zfp382 UTSW 7 30133749 missense probably benign
R4864:Zfp382 UTSW 7 30133460 missense possibly damaging 0.58
R4956:Zfp382 UTSW 7 30131554 missense probably benign 0.00
R5796:Zfp382 UTSW 7 30133349 missense probably damaging 1.00
R6062:Zfp382 UTSW 7 30133590 missense probably damaging 1.00
R6300:Zfp382 UTSW 7 30131629 splice site probably null
R6312:Zfp382 UTSW 7 30134538 missense probably damaging 0.99
R6894:Zfp382 UTSW 7 30125836 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCTACCTTATCGAGCACG -3'
(R):5'- GGGTAATGAGGTTCGATTTACAGC -3'

Sequencing Primer
(F):5'- GAGAAGCCCTACATTTGCTGTCAG -3'
(R):5'- GCTAAAGAATTTTCCACACTCTTGAC -3'
Posted On2017-01-03