Incidental Mutation 'R5734:Sox6'
ID451589
Institutional Source Beutler Lab
Gene Symbol Sox6
Ensembl Gene ENSMUSG00000051910
Gene NameSRY (sex determining region Y)-box 6
Synonyms
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location115470872-116038796 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 115541621 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]
Predicted Effect probably null
Transcript: ENSMUST00000072804
SMART Domains Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 462 484 N/A INTRINSIC
low complexity region 507 517 N/A INTRINSIC
HMG 619 689 1.5e-25 SMART
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106612
SMART Domains Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 420 442 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
HMG 577 647 1.5e-25 SMART
low complexity region 755 767 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166207
SMART Domains Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 462 484 N/A INTRINSIC
low complexity region 507 517 N/A INTRINSIC
HMG 619 689 1.5e-25 SMART
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166877
SMART Domains Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910

DomainStartEndE-ValueType
coiled coil region 184 263 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
low complexity region 422 444 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
HMG 579 649 1.5e-25 SMART
low complexity region 757 769 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169129
SMART Domains Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910

DomainStartEndE-ValueType
coiled coil region 184 263 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
low complexity region 422 444 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
HMG 579 649 1.5e-25 SMART
low complexity region 757 769 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205980
Predicted Effect probably null
Transcript: ENSMUST00000206034
Predicted Effect probably null
Transcript: ENSMUST00000206369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206775
Meta Mutation Damage Score 0.53 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Sox6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Sox6 APN 7 115477206 missense probably benign
IGL00957:Sox6 APN 7 115777092 missense probably damaging 1.00
IGL01624:Sox6 APN 7 115476968 missense probably damaging 1.00
IGL02057:Sox6 APN 7 115550075 missense probably damaging 1.00
IGL02385:Sox6 APN 7 115550039 missense possibly damaging 0.77
IGL02410:Sox6 APN 7 115486744 missense probably damaging 1.00
IGL02736:Sox6 APN 7 115580640 missense probably damaging 1.00
IGL02747:Sox6 APN 7 115489746 missense probably damaging 1.00
IGL02792:Sox6 APN 7 115541649 missense probably benign
PIT4480001:Sox6 UTSW 7 115597509 missense probably benign 0.03
R0458:Sox6 UTSW 7 115489794 missense probably damaging 1.00
R0689:Sox6 UTSW 7 115486551 missense probably damaging 1.00
R0800:Sox6 UTSW 7 115579014 critical splice donor site probably null
R1220:Sox6 UTSW 7 115662442 missense probably damaging 1.00
R1474:Sox6 UTSW 7 115701691 splice site probably benign
R1547:Sox6 UTSW 7 115701722 missense possibly damaging 0.93
R1570:Sox6 UTSW 7 115777123 missense probably damaging 1.00
R1674:Sox6 UTSW 7 115801419 missense probably benign 0.00
R1704:Sox6 UTSW 7 115476948 missense possibly damaging 0.92
R1754:Sox6 UTSW 7 115477055 missense probably benign
R1833:Sox6 UTSW 7 115777093 missense probably damaging 1.00
R1868:Sox6 UTSW 7 115659538 missense possibly damaging 0.89
R1893:Sox6 UTSW 7 115544568 missense probably benign 0.28
R2386:Sox6 UTSW 7 115597505 missense probably damaging 1.00
R2431:Sox6 UTSW 7 115550007 splice site probably null
R4303:Sox6 UTSW 7 115544469 critical splice donor site probably null
R4319:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4320:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4321:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4323:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4335:Sox6 UTSW 7 115512724 missense probably benign
R4567:Sox6 UTSW 7 115662322 missense probably benign 0.26
R4776:Sox6 UTSW 7 115541670 missense probably damaging 1.00
R4838:Sox6 UTSW 7 115486662 missense probably damaging 1.00
R4914:Sox6 UTSW 7 115476964 missense probably damaging 1.00
R4915:Sox6 UTSW 7 115476964 missense probably damaging 1.00
R5184:Sox6 UTSW 7 115777228 missense probably damaging 1.00
R5372:Sox6 UTSW 7 115550151 nonsense probably null
R5454:Sox6 UTSW 7 115701773 missense possibly damaging 0.89
R5663:Sox6 UTSW 7 115550054 missense probably benign
R5685:Sox6 UTSW 7 115579157 intron probably null
R6020:Sox6 UTSW 7 115486628 missense probably damaging 1.00
R6211:Sox6 UTSW 7 115801462 missense probably damaging 1.00
R6263:Sox6 UTSW 7 115477060 missense probably damaging 1.00
R6549:Sox6 UTSW 7 115486692 missense possibly damaging 0.79
R6576:Sox6 UTSW 7 115701702 missense probably damaging 0.96
R6680:Sox6 UTSW 7 115476983 missense possibly damaging 0.94
R6709:Sox6 UTSW 7 115701789 splice site probably null
R6747:Sox6 UTSW 7 115541731 missense probably damaging 1.00
R6755:Sox6 UTSW 7 115662442 missense probably damaging 0.99
R7233:Sox6 UTSW 7 115489809 missense possibly damaging 0.80
X0061:Sox6 UTSW 7 115477148 missense probably benign 0.00
X0065:Sox6 UTSW 7 115550108 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCAACCTAAGTGCCCATC -3'
(R):5'- TGAGAGACTATGTCCCCACAC -3'

Sequencing Primer
(F):5'- TAAGTGCCCATCAGCAGGG -3'
(R):5'- TCACCCTGTGTATGCAGATATAC -3'
Posted On2017-01-03