Incidental Mutation 'R5734:Cacna1a'
ID451593
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84583731 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1425 (M1425V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000121390
AA Change: M1473V

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: M1473V

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122053
AA Change: M1426V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: M1426V

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126302
Predicted Effect probably damaging
Transcript: ENSMUST00000215756
AA Change: M1425V

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
R7270:Cacna1a UTSW 8 84571237 missense probably damaging 1.00
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CAGGGTCCTCAAGCACTCA -3'
(R):5'- ACATTTGCTGTTGTTGTGTTCTCAA -3'

Sequencing Primer
(F):5'- TCCTCAAGCACTCAGTGGATG -3'
(R):5'- CTTCATACCTAGAGGCAGTCATG -3'
Posted On2017-01-03