Incidental Mutation 'R5734:Glipr1'
ID451597
Institutional Source Beutler Lab
Gene Symbol Glipr1
Ensembl Gene ENSMUSG00000056888
Gene NameGLI pathogenesis-related 1 (glioma)
SynonymsRTVP1, RTVP-1, 2410114O14Rik, mRTVP-1
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location111985448-112002631 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 111985793 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 200 (R200*)
Ref Sequence ENSEMBL: ENSMUSP00000123990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074805] [ENSMUST00000161870] [ENSMUST00000162508] [ENSMUST00000163048] [ENSMUST00000174653]
Predicted Effect probably null
Transcript: ENSMUST00000074805
AA Change: R200*
SMART Domains Protein: ENSMUSP00000074359
Gene: ENSMUSG00000056888
AA Change: R200*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075924
Predicted Effect probably null
Transcript: ENSMUST00000161870
AA Change: R78*
SMART Domains Protein: ENSMUSP00000134094
Gene: ENSMUSG00000056888
AA Change: R78*

DomainStartEndE-ValueType
Pfam:CAP 1 42 9.2e-10 PFAM
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162508
AA Change: R200*
SMART Domains Protein: ENSMUSP00000123990
Gene: ENSMUSG00000056888
AA Change: R200*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163048
SMART Domains Protein: ENSMUSP00000125746
Gene: ENSMUSG00000063334

DomainStartEndE-ValueType
KH 138 210 4.85e-6 SMART
low complexity region 246 264 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
low complexity region 339 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174653
SMART Domains Protein: ENSMUSP00000134408
Gene: ENSMUSG00000063334

DomainStartEndE-ValueType
KH 138 210 4.85e-6 SMART
low complexity region 265 277 N/A INTRINSIC
low complexity region 282 306 N/A INTRINSIC
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to both the pathogenesis-related protein (PR) superfamily and the cysteine-rich secretory protein (CRISP) family. Increased expression of this gene is associated with myelomocytic differentiation in macrophage and decreased expression of this gene through gene methylation is associated with prostate cancer. The protein has proapoptotic activities in prostate and bladder cancer cells. This gene is a member of a cluster on chromosome 12 containing two other similar genes. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene renders mice more vulnerable to spontaneous tumorigenesis, leading to the formation of a wide spectrum of tumors and significantly shorter tumor-free survival times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Glipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Glipr1 APN 10 111985650 missense probably benign
IGL00553:Glipr1 APN 10 111986669 missense possibly damaging 0.79
IGL02391:Glipr1 APN 10 111988894 unclassified probably benign
R0115:Glipr1 UTSW 10 111993541 missense probably benign 0.00
R0486:Glipr1 UTSW 10 111996849 splice site probably benign
R1349:Glipr1 UTSW 10 111993532 missense probably benign 0.02
R1822:Glipr1 UTSW 10 111996860 missense possibly damaging 0.84
R4364:Glipr1 UTSW 10 111985637 missense possibly damaging 0.84
R4905:Glipr1 UTSW 10 111985640 missense probably damaging 1.00
R4974:Glipr1 UTSW 10 111993506 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGAGATGTGTATCTGTTACGC -3'
(R):5'- TGGATGAGAAACTGCTACCTCC -3'

Sequencing Primer
(F):5'- TTACGCAGGTATATAGGCCAGTC -3'
(R):5'- GATGAGAAACTGCTACCTCCTTCATC -3'
Posted On2017-01-03