Incidental Mutation 'R5734:Ofcc1'
ID451603
Institutional Source Beutler Lab
Gene Symbol Ofcc1
Ensembl Gene ENSMUSG00000047094
Gene Nameorofacial cleft 1 candidate 1
SynonymsOpo, ojoplano
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location40001882-40361450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40087849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 728 (T728S)
Ref Sequence ENSEMBL: ENSMUSP00000062217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054635] [ENSMUST00000224909]
Predicted Effect probably damaging
Transcript: ENSMUST00000054635
AA Change: T728S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062217
Gene: ENSMUSG00000047094
AA Change: T728S

DomainStartEndE-ValueType
Pfam:OFCC1 5 113 1.3e-57 PFAM
transmembrane domain 575 592 N/A INTRINSIC
transmembrane domain 599 618 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224909
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skull morphology and normal behavior with in increase in gamma-glutamyl transpeptidase. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Ofcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Ofcc1 APN 13 40142804 missense probably damaging 0.97
IGL00489:Ofcc1 APN 13 40280491 missense probably damaging 1.00
IGL01952:Ofcc1 APN 13 40280861 missense probably damaging 1.00
IGL02126:Ofcc1 APN 13 40208775 missense probably benign
IGL02619:Ofcc1 APN 13 40097077 missense possibly damaging 0.68
IGL03069:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03133:Ofcc1 APN 13 40072768 missense probably benign 0.36
IGL03273:Ofcc1 APN 13 40180525 missense probably damaging 1.00
IGL03343:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03349:Ofcc1 APN 13 40072752 missense probably benign 0.13
IGL03399:Ofcc1 APN 13 40142838 missense possibly damaging 0.56
LCD18:Ofcc1 UTSW 13 40092967 intron probably benign
R0122:Ofcc1 UTSW 13 40280556 splice site probably null
R0320:Ofcc1 UTSW 13 40206696 missense probably benign 0.01
R0386:Ofcc1 UTSW 13 40214474 nonsense probably null
R0390:Ofcc1 UTSW 13 40015313 missense possibly damaging 0.85
R0829:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0866:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0945:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0981:Ofcc1 UTSW 13 40072698 missense probably damaging 1.00
R1055:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1056:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1186:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1187:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1400:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1411:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R1419:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1474:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1636:Ofcc1 UTSW 13 40180428 missense possibly damaging 0.86
R1691:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1886:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R1887:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R2176:Ofcc1 UTSW 13 40097119 missense probably benign
R2189:Ofcc1 UTSW 13 40180448 missense probably benign
R2242:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R2255:Ofcc1 UTSW 13 40094705 missense probably damaging 0.99
R2471:Ofcc1 UTSW 13 40097025 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40072760 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40087938 missense possibly damaging 0.56
R4366:Ofcc1 UTSW 13 40015461 missense probably benign 0.18
R4573:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4574:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4656:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4657:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4673:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4782:Ofcc1 UTSW 13 40001892 synonymous probably null
R4790:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4823:Ofcc1 UTSW 13 40280473 missense probably damaging 0.99
R4834:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4840:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4842:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4889:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4919:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4920:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4921:Ofcc1 UTSW 13 40214517 missense probably benign 0.10
R4948:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4953:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4961:Ofcc1 UTSW 13 40263559 critical splice donor site probably null
R5339:Ofcc1 UTSW 13 40087845 missense probably benign 0.35
R5512:Ofcc1 UTSW 13 40206810 missense probably benign 0.20
R5566:Ofcc1 UTSW 13 40094653 missense probably damaging 1.00
R5672:Ofcc1 UTSW 13 40280429 missense probably damaging 0.98
R5839:Ofcc1 UTSW 13 40280545 missense probably damaging 1.00
R5853:Ofcc1 UTSW 13 40206717 missense probably benign 0.00
R5896:Ofcc1 UTSW 13 40180584 missense probably benign 0.01
R5909:Ofcc1 UTSW 13 40263578 missense possibly damaging 0.92
R5995:Ofcc1 UTSW 13 40280422 missense probably damaging 1.00
R6306:Ofcc1 UTSW 13 40148576 missense probably benign
R6460:Ofcc1 UTSW 13 40287979 missense probably damaging 0.99
R6504:Ofcc1 UTSW 13 40097055 missense probably damaging 1.00
R6797:Ofcc1 UTSW 13 40087947 missense possibly damaging 0.75
R7091:Ofcc1 UTSW 13 40072767 missense probably damaging 0.99
R7098:Ofcc1 UTSW 13 40003966 critical splice donor site probably null
R7142:Ofcc1 UTSW 13 40004062 missense probably benign 0.00
R7240:Ofcc1 UTSW 13 40208841 missense probably benign
X0005:Ofcc1 UTSW 13 40142790 missense probably benign 0.01
X0005:Ofcc1 UTSW 13 40280532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTCTGCCTGAAGAGTTAGGTG -3'
(R):5'- TGGTACCTTAGAGTTTCATGTCC -3'

Sequencing Primer
(F):5'- CCTGAAGAGTTAGGTGTTTCTAATC -3'
(R):5'- TGTCCTTAAATTAATCTGACATGACG -3'
Posted On2017-01-03