Incidental Mutation 'R5734:Smad5'
ID451604
Institutional Source Beutler Lab
Gene Symbol Smad5
Ensembl Gene ENSMUSG00000021540
Gene NameSMAD family member 5
SynonymsSmad 5, Madh5, MusMLP
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56703010-56742377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56723804 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 71 (S71T)
Ref Sequence ENSEMBL: ENSMUSP00000105502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069557] [ENSMUST00000109874] [ENSMUST00000109876]
Predicted Effect probably damaging
Transcript: ENSMUST00000069557
AA Change: S71T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065798
Gene: ENSMUSG00000021540
AA Change: S71T

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109874
AA Change: S71T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105500
Gene: ENSMUSG00000021540
AA Change: S71T

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109876
AA Change: S71T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105502
Gene: ENSMUSG00000021540
AA Change: S71T

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138677
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. The encoded protein is activated by bone morphogenetic proteins type 1 receptor kinase, and may be involved in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit vascular, craniofacial, and neural tube defects, improper turning, edema, and a deficiency of primordial germ cells. Mutants die between embryonic days 10.5 and 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Smad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Smad5 APN 13 56723667 missense probably benign 0.11
IGL01407:Smad5 APN 13 56735817 missense probably benign 0.00
IGL02267:Smad5 APN 13 56735790 splice site probably benign
IGL03014:Smad5 UTSW 13 56735941 missense probably damaging 1.00
R1317:Smad5 UTSW 13 56736071 splice site probably benign
R2001:Smad5 UTSW 13 56737374 missense probably damaging 0.99
R5401:Smad5 UTSW 13 56727469 missense probably benign 0.00
R5551:Smad5 UTSW 13 56735841 missense probably damaging 1.00
R5796:Smad5 UTSW 13 56723832 missense probably damaging 0.98
R5988:Smad5 UTSW 13 56735985 missense probably damaging 0.99
Z1088:Smad5 UTSW 13 56728628 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCAATGGCCAGCTTGTTTTC -3'
(R):5'- GAAACTTACCTGGACTCTCCAC -3'

Sequencing Primer
(F):5'- TTCACTAGTCCAGCCGTGAAG -3'
(R):5'- TGGACTCTCCACTCTCTTATAGTG -3'
Posted On2017-01-03