Incidental Mutation 'R5734:Skp2'
ID451606
Institutional Source Beutler Lab
Gene Symbol Skp2
Ensembl Gene ENSMUSG00000054115
Gene NameS-phase kinase-associated protein 2 (p45)
SynonymsFBXL1
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9111985-9155425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9139479 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 43 (D43G)
Ref Sequence ENSEMBL: ENSMUSP00000139997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090380] [ENSMUST00000096482] [ENSMUST00000110585] [ENSMUST00000190131] [ENSMUST00000227556]
Predicted Effect probably benign
Transcript: ENSMUST00000090380
SMART Domains Protein: ENSMUSP00000087858
Gene: ENSMUSG00000039704

DomainStartEndE-ValueType
Pfam:LMBR1 8 546 4.2e-192 PFAM
low complexity region 574 598 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096482
AA Change: D78G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094225
Gene: ENSMUSG00000054115
AA Change: D78G

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
LRR 205 229 1.27e2 SMART
LRR 230 254 1.28e1 SMART
LRR 255 280 2.91e1 SMART
LRR 334 359 2.83e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110585
AA Change: D78G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106215
Gene: ENSMUSG00000054115
AA Change: D78G

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
Blast:LRR 205 229 5e-7 BLAST
Blast:LRR 229 253 3e-7 BLAST
Blast:LRR 255 284 3e-10 BLAST
Blast:LRR 309 334 3e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000190131
AA Change: D43G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115
AA Change: D43G

DomainStartEndE-ValueType
FBOX 65 105 2.3e-10 SMART
LRR 170 194 5.3e-1 SMART
LRR 195 219 5.3e-2 SMART
LRR 220 245 1.2e-1 SMART
LRR 299 324 1.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191316
Predicted Effect probably benign
Transcript: ENSMUST00000227556
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, enlarged cell and nuclear sizes, polyploidy, reduced cell growth rate, overduplication of centrosomes, increased apoptosis rate, delayed wound healing, and aberrant immunoglobulin V(D)J recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Skp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Skp2 APN 15 9139487 missense probably benign 0.00
IGL02135:Skp2 APN 15 9125147 missense probably benign
R0050:Skp2 UTSW 15 9125091 missense probably benign 0.03
R0129:Skp2 UTSW 15 9125193 missense probably damaging 1.00
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1503:Skp2 UTSW 15 9127911 missense probably damaging 1.00
R1660:Skp2 UTSW 15 9125114 missense probably benign 0.03
R1746:Skp2 UTSW 15 9139443 missense possibly damaging 0.58
R2031:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2034:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2087:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2088:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2090:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2091:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R4272:Skp2 UTSW 15 9116860 critical splice donor site probably null
R4428:Skp2 UTSW 15 9116947 missense probably benign 0.21
R4747:Skp2 UTSW 15 9113839 missense possibly damaging 0.93
R6963:Skp2 UTSW 15 9139428 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACCAAAACTAGGCAATTTTAGGC -3'
(R):5'- AAGCACCTTCAGGAGATTCCG -3'

Sequencing Primer
(F):5'- GGCAATTTTAGGCACCGATC -3'
(R):5'- TTCAGGAGATTCCGGACCAG -3'
Posted On2017-01-03