Incidental Mutation 'R5734:Usp7'
ID451609
Institutional Source Beutler Lab
Gene Symbol Usp7
Ensembl Gene ENSMUSG00000022710
Gene Nameubiquitin specific peptidase 7
Synonyms2210010O09Rik
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location8689595-8792308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8701981 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 178 (N178D)
Ref Sequence ENSEMBL: ENSMUSP00000133398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160326] [ENSMUST00000160405] [ENSMUST00000161046] [ENSMUST00000172505]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159509
Predicted Effect probably benign
Transcript: ENSMUST00000160326
SMART Domains Protein: ENSMUSP00000124576
Gene: ENSMUSG00000022710

DomainStartEndE-ValueType
PDB:2F1Z|B 43 83 2e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160405
AA Change: N459D

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124382
Gene: ENSMUSG00000022710
AA Change: N459D

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
MATH 111 217 4.27e-22 SMART
Pfam:UCH 254 559 5.7e-53 PFAM
Pfam:UCH_1 255 528 3.7e-22 PFAM
Pfam:USP7_ICP0_bdg 661 906 7.1e-79 PFAM
Pfam:USP7_C2 916 1127 4.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161046
AA Change: N419D

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124093
Gene: ENSMUSG00000022710
AA Change: N419D

DomainStartEndE-ValueType
MATH 71 177 4.27e-22 SMART
Pfam:UCH 214 519 9.6e-60 PFAM
Pfam:UCH_1 215 488 5.1e-29 PFAM
Pfam:USP7_ICP0_bdg 620 866 5e-83 PFAM
Pfam:USP7_C2 875 1089 2.7e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162929
Predicted Effect possibly damaging
Transcript: ENSMUST00000172505
AA Change: N178D

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133398
Gene: ENSMUSG00000022710
AA Change: N178D

DomainStartEndE-ValueType
Pfam:UCH_1 5 247 1.7e-18 PFAM
Pfam:UCH 5 278 2.8e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173939
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase C19 family, which includes ubiquitinyl hydrolases. This protein deubiquitinates target proteins such as p53 (a tumor suppressor protein) and WASH (essential for endosomal protein recycling), and regulates their activities by counteracting the opposing ubiquitin ligase activity of proteins such as HDM2 and TRIM27, involved in the respective process. Mutations in this gene have been implicated in a neurodevelopmental disorder. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic growth arrest and die between E6.5 and E7.5. Mice homozygous for a conditional allele activated in neural cells exhibit complete neonatal lethality, absent gastric milk, uncoordinated movement and abnormalforebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Usp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Usp7 APN 16 8697975 missense probably damaging 0.96
IGL00496:Usp7 APN 16 8695113 missense probably damaging 0.99
IGL02113:Usp7 APN 16 8716513 critical splice donor site probably null
IGL02873:Usp7 APN 16 8695194 unclassified probably benign
IGL03036:Usp7 APN 16 8738214 missense probably benign 0.00
PIT4402001:Usp7 UTSW 16 8698495 missense probably benign
R0066:Usp7 UTSW 16 8691418 missense probably benign
R0400:Usp7 UTSW 16 8716632 splice site probably benign
R0483:Usp7 UTSW 16 8699262 missense probably damaging 1.00
R0625:Usp7 UTSW 16 8704982 missense probably benign 0.00
R0626:Usp7 UTSW 16 8693914 missense possibly damaging 0.54
R0837:Usp7 UTSW 16 8703502 missense probably damaging 1.00
R0967:Usp7 UTSW 16 8696654 unclassified probably benign
R1929:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2270:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2271:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2272:Usp7 UTSW 16 8698469 missense probably benign 0.00
R3949:Usp7 UTSW 16 8716564 missense probably damaging 1.00
R4411:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4413:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4500:Usp7 UTSW 16 8695895 missense possibly damaging 0.89
R4651:Usp7 UTSW 16 8698414 intron probably benign
R4852:Usp7 UTSW 16 8756844 nonsense probably null
R5483:Usp7 UTSW 16 8698540 missense probably benign
R5610:Usp7 UTSW 16 8716510 splice site probably null
R5964:Usp7 UTSW 16 8712102 missense possibly damaging 0.52
R6753:Usp7 UTSW 16 8696911 missense probably benign 0.25
R7171:Usp7 UTSW 16 8716526 missense probably benign 0.01
R7263:Usp7 UTSW 16 8696724 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTTCAATGTGGCAGAGCAGAG -3'
(R):5'- AGGTAGGAGGGTCACTATAAGTTC -3'

Sequencing Primer
(F):5'- TGTGGCAGAGCAGAGGGTTG -3'
(R):5'- GTTTATAAAGTGAGACCTCCCCC -3'
Posted On2017-01-03