Incidental Mutation 'R5734:Rpgr'
ID451617
Institutional Source Beutler Lab
Gene Symbol Rpgr
Ensembl Gene ENSMUSG00000031174
Gene Nameretinitis pigmentosa GTPase regulator
SynonymsRp3h
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5734 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location10073621-10216920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10166272 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 857 (P857L)
Ref Sequence ENSEMBL: ENSMUSP00000111194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044598] [ENSMUST00000072393] [ENSMUST00000073392] [ENSMUST00000115532] [ENSMUST00000115533] [ENSMUST00000115534]
Predicted Effect probably benign
Transcript: ENSMUST00000044598
AA Change: P857L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037358
Gene: ENSMUSG00000031174
AA Change: P857L

DomainStartEndE-ValueType
Pfam:RCC1 91 140 2.4e-12 PFAM
Pfam:RCC1 143 193 2.1e-7 PFAM
Pfam:RCC1_2 180 209 4.5e-11 PFAM
Pfam:RCC1 196 243 2.2e-12 PFAM
Pfam:RCC1 246 296 6.3e-13 PFAM
Pfam:RCC1 300 348 9.9e-13 PFAM
Pfam:RCC1 352 402 2.5e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
low complexity region 820 829 N/A INTRINSIC
low complexity region 879 897 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072393
AA Change: P564L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072229
Gene: ENSMUSG00000031174
AA Change: P564L

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 3e-8 PFAM
Pfam:RCC1 91 140 3.1e-13 PFAM
Pfam:RCC1 143 193 7.5e-9 PFAM
Pfam:RCC1_2 180 209 1.5e-11 PFAM
Pfam:RCC1 196 243 2.6e-13 PFAM
Pfam:RCC1 246 296 4.4e-13 PFAM
Pfam:RCC1 300 348 1.7e-12 PFAM
Pfam:RCC1 352 402 1.3e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 586 604 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073392
AA Change: P564L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073106
Gene: ENSMUSG00000031174
AA Change: P564L

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 3.3e-8 PFAM
Pfam:RCC1 91 140 3.5e-13 PFAM
Pfam:RCC1 143 193 8.4e-9 PFAM
Pfam:RCC1_2 180 209 1.7e-11 PFAM
Pfam:RCC1 196 243 3e-13 PFAM
Pfam:RCC1 246 296 4.9e-13 PFAM
Pfam:RCC1 300 348 1.9e-12 PFAM
Pfam:RCC1 352 402 1.5e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 586 604 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115532
AA Change: P857L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111194
Gene: ENSMUSG00000031174
AA Change: P857L

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 1.1e-7 PFAM
Pfam:RCC1 91 140 1.3e-12 PFAM
Pfam:RCC1 143 193 3.1e-8 PFAM
Pfam:RCC1_2 180 209 5.5e-11 PFAM
Pfam:RCC1 196 243 1.1e-12 PFAM
Pfam:RCC1 246 296 1.8e-12 PFAM
Pfam:RCC1 300 348 6.8e-12 PFAM
Pfam:RCC1 352 402 5.4e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
low complexity region 820 829 N/A INTRINSIC
low complexity region 879 897 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115533
AA Change: P564L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111195
Gene: ENSMUSG00000031174
AA Change: P564L

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 7.1e-8 PFAM
Pfam:RCC1 91 140 8.4e-13 PFAM
Pfam:RCC1 143 193 2e-8 PFAM
Pfam:RCC1_2 180 209 3.7e-11 PFAM
Pfam:RCC1 196 243 7.1e-13 PFAM
Pfam:RCC1 246 296 1.2e-12 PFAM
Pfam:RCC1 300 348 4.4e-12 PFAM
Pfam:RCC1 352 402 3.5e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 586 604 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115534
AA Change: P469L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111196
Gene: ENSMUSG00000031174
AA Change: P469L

DomainStartEndE-ValueType
Pfam:RCC1 1 45 9.6e-11 PFAM
Pfam:RCC1 48 98 3.2e-8 PFAM
Pfam:RCC1_2 85 114 6.1e-11 PFAM
Pfam:RCC1 101 148 1.1e-12 PFAM
Pfam:RCC1 151 201 1.9e-12 PFAM
Pfam:RCC1 205 253 7.1e-12 PFAM
Pfam:RCC1 257 307 5.6e-9 PFAM
low complexity region 338 365 N/A INTRINSIC
low complexity region 491 509 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a series of six RCC1-like domains (RLDs), characteristic of the highly conserved guanine nucleotide exchange factors. The encoded protein is found in the Golgi body and interacts with RPGRIP1. This protein localizes to the outer segment of rod photoreceptors and is essential for their viability. Mutations in this gene have been associated with X-linked retinitis pigmentosa (XLRP). Multiple alternatively spliced transcript variants that encode different isoforms of this gene have been reported, but the full-length natures of only some have been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homo- and hemizygotes for an X-linked, targeted, null mutation exhibit ectopic placement of cone opsins, reduced levels of rhodopsin in rod cells, and partial degeneration of both cone and rod photoreceptors by 2-6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Rpgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Rpgr APN X 10208709 missense possibly damaging 0.63
IGL02394:Rpgr APN X 10166217 missense probably benign 0.30
IGL02401:Rpgr APN X 10158717 missense possibly damaging 0.78
R3434:Rpgr UTSW X 10176602 missense probably benign 0.05
R4598:Rpgr UTSW X 10196016 missense probably benign 0.00
R5732:Rpgr UTSW X 10166272 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CAGGACATAACCTTGTCGCG -3'
(R):5'- CTGATGCAGTATCTTCATGTTCAG -3'

Sequencing Primer
(F):5'- GGACATAACCTTGTCGCGATACC -3'
(R):5'- GCAGTATCTTCATGTTCAGCATAGGC -3'
Posted On2017-01-03