Incidental Mutation 'R5735:Tns1'
ID451618
Institutional Source Beutler Lab
Gene Symbol Tns1
Ensembl Gene ENSMUSG00000055322
Gene Nametensin 1
Synonyms1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns
MMRRC Submission 043349-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R5735 (G1)
Quality Score175
Status Not validated
Chromosome1
Chromosomal Location73910231-74124449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73927979 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1212 (T1212A)
Ref Sequence ENSEMBL: ENSMUSP00000148638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000187691] [ENSMUST00000191104] [ENSMUST00000212888]
Predicted Effect probably benign
Transcript: ENSMUST00000169786
AA Change: T1220A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: T1220A

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185264
Predicted Effect unknown
Transcript: ENSMUST00000185331
AA Change: T1037A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185529
Predicted Effect unknown
Transcript: ENSMUST00000185702
AA Change: T1050A
Predicted Effect probably benign
Transcript: ENSMUST00000187584
AA Change: T1155A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: T1155A

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187691
SMART Domains Protein: ENSMUSP00000139844
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
SH2 350 452 4.3e-19 SMART
PTB 483 624 9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189228
Predicted Effect probably benign
Transcript: ENSMUST00000191104
AA Change: T1199A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: T1199A

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191527
Predicted Effect probably benign
Transcript: ENSMUST00000212888
AA Change: T1212A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,796 E209G probably benign Het
4930430A15Rik A T 2: 111,225,492 L183* probably null Het
9130019O22Rik G T 7: 127,385,407 H174Q possibly damaging Het
Adamts16 C A 13: 70,836,218 D109Y possibly damaging Het
Armc8 T A 9: 99,497,394 probably null Het
Atg4b G T 1: 93,773,797 G71V probably damaging Het
Atp10b A T 11: 43,151,774 M54L probably benign Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Bnc2 A C 4: 84,292,671 L487R probably damaging Het
C330027C09Rik T A 16: 49,017,493 probably null Het
Cacng7 T C 7: 3,339,023 S141P probably benign Het
Carmil2 G A 8: 105,698,031 G1361D probably damaging Het
Cenpf T C 1: 189,654,363 I1907V probably benign Het
Cep192 T C 18: 67,880,795 V2422A probably benign Het
Cfap73 T A 5: 120,632,606 Q33L probably benign Het
Cmtm2a A T 8: 104,292,786 I57N probably damaging Het
Col6a2 T A 10: 76,599,893 D836V probably benign Het
Dnah2 A G 11: 69,430,817 V3839A possibly damaging Het
Enpp1 A T 10: 24,654,919 F546L possibly damaging Het
Eps8l2 A G 7: 141,360,377 T507A probably damaging Het
Erg28 C T 12: 85,816,152 E129K probably benign Het
Erlec1 A T 11: 30,950,591 N153K probably benign Het
Fam234a T C 17: 26,213,705 E490G probably damaging Het
Fat4 C T 3: 38,949,576 R1815C probably damaging Het
Galnt1 T G 18: 24,264,520 I226S possibly damaging Het
Gm13088 A T 4: 143,654,635 C273S probably damaging Het
Ifnl2 T A 7: 28,510,189 I58F possibly damaging Het
Itih5 A G 2: 10,240,761 N554D probably benign Het
Kcna10 A G 3: 107,195,078 I342V probably benign Het
Kif6 G A 17: 49,832,182 E561K probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lpar2 G T 8: 69,823,735 R58L probably damaging Het
Macrod2 A G 2: 140,418,889 T27A possibly damaging Het
Mfsd2a A T 4: 122,949,327 V387D probably damaging Het
Npas3 A T 12: 54,003,479 T231S probably benign Het
Olfr1100 A G 2: 86,978,700 V32A probably benign Het
Olfr1107 A T 2: 87,071,412 C241S probably damaging Het
Olfr1242 A T 2: 89,493,468 N281K probably damaging Het
Olfr669 A T 7: 104,938,759 T78S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde10a A T 17: 8,941,192 I432F probably damaging Het
Phka2 ACC AC X: 160,559,866 probably null Het
Pomt1 G A 2: 32,243,505 G218R probably damaging Het
Prdm5 C T 6: 65,927,990 T157I possibly damaging Het
Psen2 T A 1: 180,240,926 E54V probably benign Het
Ptpn13 C A 5: 103,554,820 H1217Q probably benign Het
Ptprt A G 2: 161,534,564 S1306P probably damaging Het
Ptpru G T 4: 131,838,090 P23T probably benign Het
Rtn3 T C 19: 7,456,692 E626G probably damaging Het
Scn3a A T 2: 65,482,278 M1191K probably damaging Het
Scn3a T A 2: 65,484,459 N1086I probably benign Het
Sgms2 A T 3: 131,336,217 M174K probably damaging Het
Skor1 T A 9: 63,146,064 I180F probably damaging Het
Slit2 T G 5: 48,259,616 C1003W probably damaging Het
Tbc1d2b T A 9: 90,222,409 Q560L possibly damaging Het
Tcrg-V5 T G 13: 19,192,525 H47Q probably benign Het
Themis A G 10: 28,722,534 I51V probably benign Het
Tmem203 T C 2: 25,256,073 V135A probably benign Het
Trim2 G A 3: 84,167,722 A697V probably damaging Het
Ubxn4 T C 1: 128,258,940 S37P possibly damaging Het
Vmn2r17 A G 5: 109,452,850 I671M possibly damaging Het
Vmn2r94 G T 17: 18,243,804 S741R probably damaging Het
Vwce C A 19: 10,647,067 D414E probably benign Het
Zfp397 T C 18: 23,960,192 S245P possibly damaging Het
Zfp809 T A 9: 22,238,931 Y241* probably null Het
Zfp995 C T 17: 21,882,029 C29Y probably benign Het
Zfyve26 T C 12: 79,273,373 D1066G probably damaging Het
Other mutations in Tns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tns1 APN 1 73924969 missense probably damaging 0.99
IGL01288:Tns1 APN 1 73953810 missense probably damaging 1.00
IGL01536:Tns1 APN 1 73919648 splice site probably benign
IGL01568:Tns1 APN 1 73953509 missense probably damaging 1.00
IGL01683:Tns1 APN 1 73953269 missense probably damaging 0.98
IGL02267:Tns1 APN 1 73992131 missense possibly damaging 0.95
IGL02597:Tns1 APN 1 73985873 critical splice donor site probably null
IGL02819:Tns1 APN 1 73937248 missense probably damaging 0.99
IGL03370:Tns1 APN 1 73985894 missense probably damaging 1.00
R0087:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R0207:Tns1 UTSW 1 73937318 critical splice acceptor site probably null
R0411:Tns1 UTSW 1 73925761 missense probably damaging 0.96
R0543:Tns1 UTSW 1 73952697 missense probably benign 0.01
R0552:Tns1 UTSW 1 73920563 missense probably damaging 1.00
R0720:Tns1 UTSW 1 73925581 missense probably benign 0.03
R0828:Tns1 UTSW 1 73919666 missense probably damaging 1.00
R1034:Tns1 UTSW 1 73941969 missense probably damaging 1.00
R1061:Tns1 UTSW 1 73917672 missense probably damaging 1.00
R1819:Tns1 UTSW 1 73916476 splice site probably benign
R1826:Tns1 UTSW 1 73953634 start codon destroyed probably null 0.91
R2208:Tns1 UTSW 1 74079240 missense probably damaging 1.00
R3723:Tns1 UTSW 1 73924940 missense probably damaging 0.99
R4079:Tns1 UTSW 1 73995308 missense probably damaging 1.00
R4111:Tns1 UTSW 1 73941932 missense probably damaging 1.00
R4155:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4156:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4157:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4274:Tns1 UTSW 1 73928098 missense probably damaging 1.00
R4426:Tns1 UTSW 1 73985749 missense probably damaging 0.97
R4649:Tns1 UTSW 1 73953771 missense probably damaging 1.00
R4742:Tns1 UTSW 1 74124290 critical splice donor site probably null
R4869:Tns1 UTSW 1 73952615 missense probably benign
R4961:Tns1 UTSW 1 73935915 missense probably benign 0.35
R5025:Tns1 UTSW 1 73925482 missense probably damaging 1.00
R5035:Tns1 UTSW 1 73953820 start gained probably benign
R5062:Tns1 UTSW 1 73952864 missense probably damaging 1.00
R5080:Tns1 UTSW 1 73952940 missense probably damaging 1.00
R5213:Tns1 UTSW 1 73953612 missense probably damaging 1.00
R5256:Tns1 UTSW 1 73995426 intron probably benign
R5368:Tns1 UTSW 1 73941017 missense probably benign 0.07
R5391:Tns1 UTSW 1 73990409 splice site probably null
R5587:Tns1 UTSW 1 73920596 missense possibly damaging 0.94
R5855:Tns1 UTSW 1 73918033 missense possibly damaging 0.83
R5999:Tns1 UTSW 1 73928097 nonsense probably null
R6122:Tns1 UTSW 1 73952419 critical splice donor site probably null
R6148:Tns1 UTSW 1 73953453 missense probably damaging 1.00
R6457:Tns1 UTSW 1 73918050 missense probably damaging 0.99
R6525:Tns1 UTSW 1 73953470 missense probably damaging 1.00
R6712:Tns1 UTSW 1 74079301 nonsense probably null
R6773:Tns1 UTSW 1 73919707 missense probably damaging 1.00
R6825:Tns1 UTSW 1 74002323 nonsense probably null
R7085:Tns1 UTSW 1 73925462 missense probably benign 0.00
R7128:Tns1 UTSW 1 73995304 missense
R7209:Tns1 UTSW 1 73953915 missense possibly damaging 0.68
R7348:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTTAAGACTGCAGCAGAAAGC -3'
(R):5'- GGACTCCTACCACATCTATGC -3'

Sequencing Primer
(F):5'- CTATCCAAAGCTTTGAGGAAGGC -3'
(R):5'- GACTCCTACCACATCTATGCTCATTC -3'
Posted On2017-01-03