Incidental Mutation 'R5736:Prkag2'
ID451695
Institutional Source Beutler Lab
Gene Symbol Prkag2
Ensembl Gene ENSMUSG00000028944
Gene Nameprotein kinase, AMP-activated, gamma 2 non-catalytic subunit
Synonyms
MMRRC Submission 043194-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5736 (G1)
Quality Score198
Status Not validated
Chromosome5
Chromosomal Location24862744-25100642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24878722 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 88 (Y88N)
Ref Sequence ENSEMBL: ENSMUSP00000114978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030784] [ENSMUST00000076306] [ENSMUST00000114975] [ENSMUST00000131486] [ENSMUST00000150135]
Predicted Effect probably damaging
Transcript: ENSMUST00000030784
AA Change: Y327N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030784
Gene: ENSMUSG00000028944
AA Change: Y327N

DomainStartEndE-ValueType
low complexity region 9 29 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
low complexity region 113 122 N/A INTRINSIC
low complexity region 129 144 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
CBS 276 325 7.01e-6 SMART
CBS 357 406 4.28e-10 SMART
CBS 432 480 8.11e-11 SMART
CBS 504 552 3.62e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076306
AA Change: Y204N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075651
Gene: ENSMUSG00000028944
AA Change: Y204N

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
CBS 153 202 7.01e-6 SMART
CBS 234 283 4.28e-10 SMART
CBS 309 357 8.11e-11 SMART
CBS 381 429 3.62e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114975
AA Change: Y87N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110626
Gene: ENSMUSG00000028944
AA Change: Y87N

DomainStartEndE-ValueType
CBS 36 85 7.01e-6 SMART
CBS 117 166 4.28e-10 SMART
CBS 192 240 8.11e-11 SMART
CBS 264 312 3.62e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129022
Predicted Effect probably damaging
Transcript: ENSMUST00000131486
AA Change: Y69N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115760
Gene: ENSMUSG00000028944
AA Change: Y69N

DomainStartEndE-ValueType
CBS 18 67 7.01e-6 SMART
CBS 99 148 4.28e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139698
Predicted Effect probably damaging
Transcript: ENSMUST00000150135
AA Change: Y88N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114978
Gene: ENSMUSG00000028944
AA Change: Y88N

DomainStartEndE-ValueType
CBS 37 86 7.01e-6 SMART
CBS 118 167 4.28e-10 SMART
CBS 193 241 8.11e-11 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.5%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AMP-activated protein kinase (AMPK) is a heterotrimeric protein composed of a catalytic alpha subunit, a noncatalytic beta subunit, and a noncatalytic regulatory gamma subunit. Various forms of each of these subunits exist, encoded by different genes. AMPK is an important energy-sensing enzyme that monitors cellular energy status and functions by inactivating key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This gene is a member of the AMPK gamma subunit family. Mutations in this gene have been associated with Wolff-Parkinson-White syndrome, familial hypertrophic cardiomyopathy, and glycogen storage disease of the heart. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous constitutively active mutants develop age related obesity caused by polyphagia, glucose intolerance and insulin resistance and exhibit slowing of heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik G A 1: 75,220,567 probably benign Het
Akt1 G A 12: 112,656,850 R367C probably benign Het
Arl8a T A 1: 135,154,720 S150T probably benign Het
Armc4 T C 18: 7,268,416 T368A probably benign Het
B020004C17Rik A T 14: 57,017,366 T216S possibly damaging Het
Casz1 G A 4: 148,929,410 V144I probably benign Het
Cd274 G T 19: 29,382,540 L248F probably benign Het
Crisp4 T C 1: 18,115,715 T266A probably benign Het
Dlx6 A T 6: 6,863,660 H94L probably damaging Het
Exoc1 A G 5: 76,537,768 N109S possibly damaging Het
Grik2 T C 10: 49,404,410 E128G probably damaging Het
Hs3st4 G A 7: 124,397,439 E443K probably damaging Het
Ihh T C 1: 74,946,127 T400A probably benign Het
Lamb1 T A 12: 31,302,665 C806* probably null Het
Lrrn1 T C 6: 107,567,384 S48P probably damaging Het
Lsm11 T C 11: 45,944,767 N49S possibly damaging Het
Map3k11 C T 19: 5,696,711 A507V probably damaging Het
Mill2 A T 7: 18,858,249 Q265L probably benign Het
Olfr1193 T C 2: 88,678,641 M255T probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg10 T A 6: 4,754,423 L68Q probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Prmt5 A C 14: 54,514,840 D166E probably null Het
Robo4 A T 9: 37,404,797 T366S possibly damaging Het
Samd3 T C 10: 26,270,172 I365T probably damaging Het
Sdf2l1 A T 16: 17,131,707 C92S probably damaging Het
Serpinb6e A G 13: 33,832,770 F327L probably damaging Het
Slc17a6 G A 7: 51,645,093 V183I possibly damaging Het
Slc6a11 T C 6: 114,162,162 S244P probably damaging Het
Slc6a5 A G 7: 49,959,354 D769G probably benign Het
Slc7a14 A T 3: 31,223,910 D515E probably benign Het
Slco2a1 A T 9: 103,067,830 S135C probably benign Het
Spidr A T 16: 15,897,298 D801E probably damaging Het
Spta1 T C 1: 174,214,255 probably null Het
Tmem71 C T 15: 66,532,647 V264I probably benign Het
Zfp563 G T 17: 33,104,986 R185L possibly damaging Het
Zfp941 G A 7: 140,813,060 P129S probably benign Het
Other mutations in Prkag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Prkag2 APN 5 25021965 missense probably benign 0.01
R0437:Prkag2 UTSW 5 25028505 missense possibly damaging 0.65
R0622:Prkag2 UTSW 5 24869249 missense probably damaging 0.98
R0755:Prkag2 UTSW 5 24947631 missense probably benign 0.25
R1400:Prkag2 UTSW 5 24873918 missense probably damaging 1.00
R1561:Prkag2 UTSW 5 24871595 missense probably damaging 1.00
R1569:Prkag2 UTSW 5 24947477 missense possibly damaging 0.59
R1612:Prkag2 UTSW 5 24877028 missense probably benign 0.06
R1615:Prkag2 UTSW 5 24875178 missense possibly damaging 0.56
R1700:Prkag2 UTSW 5 24871541 missense probably damaging 0.97
R2011:Prkag2 UTSW 5 24871054 critical splice donor site probably null
R2045:Prkag2 UTSW 5 24947582 missense possibly damaging 0.76
R2230:Prkag2 UTSW 5 24908364 missense probably benign 0.10
R2863:Prkag2 UTSW 5 25021792 missense probably benign 0.39
R3104:Prkag2 UTSW 5 24871069 nonsense probably null
R4193:Prkag2 UTSW 5 24878760 missense probably damaging 1.00
R4520:Prkag2 UTSW 5 24866171 missense probably damaging 1.00
R4604:Prkag2 UTSW 5 24878734 missense probably damaging 1.00
R6273:Prkag2 UTSW 5 24947536 missense probably damaging 0.96
R6414:Prkag2 UTSW 5 25100180 start gained probably benign
R6510:Prkag2 UTSW 5 25100288 start gained probably benign
R6511:Prkag2 UTSW 5 25100288 start gained probably benign
R7035:Prkag2 UTSW 5 24947566 missense probably damaging 1.00
R7084:Prkag2 UTSW 5 25021969 missense probably benign
R7211:Prkag2 UTSW 5 24995298 missense probably benign 0.00
R7353:Prkag2 UTSW 5 24880686 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AACTGGTGCCTTCTCAAAGC -3'
(R):5'- CCTAGTAAGCCAGCCAGTTTATC -3'

Sequencing Primer
(F):5'- GTGCCTTCTCAAAGCGTCCAAAG -3'
(R):5'- GTAAGCCAGCCAGTTTATCCTAGG -3'
Posted On2017-01-03