Incidental Mutation 'R5736:Prmt5'
ID451716
Institutional Source Beutler Lab
Gene Symbol Prmt5
Ensembl Gene ENSMUSG00000023110
Gene Nameprotein arginine N-methyltransferase 5
SynonymsJak-binding protein 1, Jbp1, Skb1
MMRRC Submission 043194-MU
Accession Numbers

Genbank: NM_013768.3; Ensembl: ENSMUST00000023873

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5736 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54507187-54517525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 54514840 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 166 (D166E)
Ref Sequence ENSEMBL: ENSMUSP00000023873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023873] [ENSMUST00000132227] [ENSMUST00000147214]
Predicted Effect probably null
Transcript: ENSMUST00000023873
AA Change: D166E

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023873
Gene: ENSMUSG00000023110
AA Change: D166E

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
Pfam:PRMT5 181 619 4.5e-184 PFAM
Pfam:SAMBD 184 465 3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132227
SMART Domains Protein: ENSMUSP00000138549
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
PDB:4GQB|A 19 40 5e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138367
Predicted Effect probably benign
Transcript: ENSMUST00000139964
SMART Domains Protein: ENSMUSP00000121502
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
Pfam:PRMT5 1 62 1.3e-10 PFAM
Pfam:SAMBD 1 203 4.6e-68 PFAM
Pfam:PRMT5 52 203 1.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147214
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.5%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the methyltransferase family. The encoded protein catalyzes the transfer of methyl groups to the amino acid arginine, in target proteins that include histones, transcriptional elongation factors and the tumor suppressor p53. This gene plays a role in several cellular processes, including transcriptional regulation and the assembly of small nuclear ribonucleoproteins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation with failure of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(4) Gene trapped(5)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik G A 1: 75,220,567 probably benign Het
Akt1 G A 12: 112,656,850 R367C probably benign Het
Arl8a T A 1: 135,154,720 S150T probably benign Het
Armc4 T C 18: 7,268,416 T368A probably benign Het
B020004C17Rik A T 14: 57,017,366 T216S possibly damaging Het
Casz1 G A 4: 148,929,410 V144I probably benign Het
Cd274 G T 19: 29,382,540 L248F probably benign Het
Crisp4 T C 1: 18,115,715 T266A probably benign Het
Dlx6 A T 6: 6,863,660 H94L probably damaging Het
Exoc1 A G 5: 76,537,768 N109S possibly damaging Het
Grik2 T C 10: 49,404,410 E128G probably damaging Het
Hs3st4 G A 7: 124,397,439 E443K probably damaging Het
Ihh T C 1: 74,946,127 T400A probably benign Het
Lamb1 T A 12: 31,302,665 C806* probably null Het
Lrrn1 T C 6: 107,567,384 S48P probably damaging Het
Lsm11 T C 11: 45,944,767 N49S possibly damaging Het
Map3k11 C T 19: 5,696,711 A507V probably damaging Het
Mill2 A T 7: 18,858,249 Q265L probably benign Het
Olfr1193 T C 2: 88,678,641 M255T probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Peg10 T A 6: 4,754,423 L68Q probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Prkag2 A T 5: 24,878,722 Y88N probably damaging Het
Robo4 A T 9: 37,404,797 T366S possibly damaging Het
Samd3 T C 10: 26,270,172 I365T probably damaging Het
Sdf2l1 A T 16: 17,131,707 C92S probably damaging Het
Serpinb6e A G 13: 33,832,770 F327L probably damaging Het
Slc17a6 G A 7: 51,645,093 V183I possibly damaging Het
Slc6a11 T C 6: 114,162,162 S244P probably damaging Het
Slc6a5 A G 7: 49,959,354 D769G probably benign Het
Slc7a14 A T 3: 31,223,910 D515E probably benign Het
Slco2a1 A T 9: 103,067,830 S135C probably benign Het
Spidr A T 16: 15,897,298 D801E probably damaging Het
Spta1 T C 1: 174,214,255 probably null Het
Tmem71 C T 15: 66,532,647 V264I probably benign Het
Zfp563 G T 17: 33,104,986 R185L possibly damaging Het
Zfp941 G A 7: 140,813,060 P129S probably benign Het
Other mutations in Prmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prmt5 APN 14 54509877 missense probably damaging 1.00
IGL01586:Prmt5 APN 14 54509951 unclassified probably benign
IGL02063:Prmt5 APN 14 54511020 nonsense probably null
IGL02249:Prmt5 APN 14 54509865 missense probably damaging 1.00
IGL03024:Prmt5 APN 14 54516598 missense possibly damaging 0.93
skipper UTSW 14 54509911 missense probably damaging 1.00
1mM(1):Prmt5 UTSW 14 54511500 critical splice donor site probably null
R0485:Prmt5 UTSW 14 54511255 missense probably damaging 1.00
R0664:Prmt5 UTSW 14 54507856 missense probably damaging 0.99
R1473:Prmt5 UTSW 14 54508915 missense probably damaging 1.00
R2106:Prmt5 UTSW 14 54507917 missense probably benign 0.00
R2159:Prmt5 UTSW 14 54515338 missense probably benign 0.03
R4728:Prmt5 UTSW 14 54507907 missense probably benign 0.00
R4843:Prmt5 UTSW 14 54516125 missense probably benign 0.33
R5261:Prmt5 UTSW 14 54507916 missense probably damaging 0.96
R5277:Prmt5 UTSW 14 54509942 missense probably benign 0.02
R5892:Prmt5 UTSW 14 54509911 missense probably damaging 1.00
R5945:Prmt5 UTSW 14 54514887 missense possibly damaging 0.52
R7021:Prmt5 UTSW 14 54515388 missense probably damaging 1.00
R7091:Prmt5 UTSW 14 54511342 splice site probably null
R7172:Prmt5 UTSW 14 54514886 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAAGTTATGCCACCTGCCC -3'
(R):5'- AGCTAGGTATTTACACAAGGATACG -3'

Sequencing Primer
(F):5'- GTTATGCCACCTGCCCAGAATC -3'
(R):5'- GGTATTTACACAAGGATACGTATGAC -3'
Posted On2017-01-03