Incidental Mutation 'R5702:1700057G04Rik'
List |< first << previous [record 84 of 32981] next >> last >|
ID451750
Institutional Source Beutler Lab
Gene Symbol 1700057G04Rik
Ensembl Gene ENSMUSG00000074139
Gene NameRIKEN cDNA 1700057G04 gene
Synonyms
MMRRC Submission 043182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5702 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location92309377-92357876 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 92343688 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098477] [ENSMUST00000150594] [ENSMUST00000185580]
Predicted Effect probably benign
Transcript: ENSMUST00000098477
SMART Domains Protein: ENSMUSP00000096077
Gene: ENSMUSG00000074139

DomainStartEndE-ValueType
Pfam:Scramblase 1 222 6.3e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134712
Predicted Effect probably null
Transcript: ENSMUST00000150594
Predicted Effect probably null
Transcript: ENSMUST00000185580
SMART Domains Protein: ENSMUSP00000139734
Gene: ENSMUSG00000074139

DomainStartEndE-ValueType
Pfam:Scramblase 1 146 8.4e-57 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,737,752 S1018N probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
AF529169 G A 9: 89,591,155 A901V probably benign Het
Ahnak G T 19: 9,001,840 V163L probably damaging Het
Atf6b T C 17: 34,651,004 I288T possibly damaging Het
Blm A T 7: 80,458,927 V1323E probably benign Het
Brap T A 5: 121,665,143 L118Q probably damaging Het
C1qbp G A 11: 70,978,744 T171I probably benign Het
Ccdc136 C A 6: 29,412,982 H455Q probably damaging Het
Chd3 A T 11: 69,361,435 V47D possibly damaging Het
Cnot10 A C 9: 114,629,010 F143V probably damaging Het
Cnot8 T C 11: 58,114,047 S191P possibly damaging Het
Coro2b G A 9: 62,426,577 T345I probably damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dnah11 C A 12: 118,113,907 A1284S probably benign Het
Dock4 G A 12: 40,737,491 D802N probably benign Het
Dsg1a T C 18: 20,336,865 probably null Het
Elp3 C T 14: 65,577,982 R187Q probably damaging Het
Ercc3 G A 18: 32,254,153 R473Q probably damaging Het
F5 G A 1: 164,194,547 W1530* probably null Het
Fmnl1 T C 11: 103,185,665 I219T probably damaging Het
Gemin4 G A 11: 76,210,837 R1033C probably benign Het
Gm2381 T A 7: 42,822,396 I20F probably benign Het
Hmgcll1 A G 9: 76,084,390 M129V possibly damaging Het
Ltbp3 G T 19: 5,747,821 R496L probably benign Het
Mettl13 A G 1: 162,545,980 V234A probably benign Het
Olfr350 A G 2: 36,850,934 D296G probably damaging Het
Pde7a A T 3: 19,241,207 C146* probably null Het
Pla2g4e T A 2: 120,188,511 N202Y possibly damaging Het
Plk5 G A 10: 80,360,567 probably null Het
Ptpn7 A G 1: 135,133,844 T15A probably benign Het
Rrn3 T A 16: 13,813,266 Y655* probably null Het
Scarb2 C T 5: 92,451,396 G355D probably damaging Het
Scd2 G A 19: 44,298,063 A111T possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Smurf1 T C 5: 144,901,211 T57A possibly damaging Het
Spire2 C T 8: 123,346,663 P94S probably benign Het
Tex2 T C 11: 106,544,395 H237R possibly damaging Het
Vmn2r109 T C 17: 20,554,145 D316G probably benign Het
Zfp830 T A 11: 82,764,974 F201L possibly damaging Het
Zic1 A G 9: 91,364,080 F313S probably damaging Het
Other mutations in 1700057G04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:1700057G04Rik APN 9 92350952 nonsense probably null
IGL01627:1700057G04Rik APN 9 92347811 missense probably damaging 0.99
IGL02118:1700057G04Rik APN 9 92350958 nonsense probably null
R0815:1700057G04Rik UTSW 9 92351087 missense possibly damaging 0.87
R0863:1700057G04Rik UTSW 9 92351087 missense possibly damaging 0.87
R1400:1700057G04Rik UTSW 9 92351127 missense probably benign 0.00
R3689:1700057G04Rik UTSW 9 92352620 missense probably damaging 1.00
R4280:1700057G04Rik UTSW 9 92343648 missense possibly damaging 0.92
R4789:1700057G04Rik UTSW 9 92351031 missense probably damaging 0.98
R4810:1700057G04Rik UTSW 9 92354630 missense probably damaging 1.00
R4880:1700057G04Rik UTSW 9 92354612 missense probably damaging 1.00
R4987:1700057G04Rik UTSW 9 92354584 missense probably damaging 1.00
R5427:1700057G04Rik UTSW 9 92352596 missense probably benign 0.43
R5602:1700057G04Rik UTSW 9 92352668 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TAACAAACTATTTGGCTTCCTCCTG -3'
(R):5'- TCTCAACACTTGGGATACTTCTAAG -3'

Sequencing Primer
(F):5'- TTGGGAACATCTGGACACTC -3'
(R):5'- TGGCACCTAAAGTACCC -3'
Posted On2017-01-03