Incidental Mutation 'R5704:Cds2'
ID451823
Institutional Source Beutler Lab
Gene Symbol Cds2
Ensembl Gene ENSMUSG00000058793
Gene NameCDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms5730460C18Rik, 5730450N06Rik, D2Wsu127e
MMRRC Submission 043329-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5704 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132263148-132312050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132293329 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 47 (V47I)
Ref Sequence ENSEMBL: ENSMUSP00000099470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089461] [ENSMUST00000103181] [ENSMUST00000110158] [ENSMUST00000125060] [ENSMUST00000147456]
Predicted Effect probably benign
Transcript: ENSMUST00000089461
AA Change: V30I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000086886
Gene: ENSMUSG00000058793
AA Change: V30I

DomainStartEndE-ValueType
Pfam:CTP_transf_1 52 382 5e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103181
AA Change: V47I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099470
Gene: ENSMUSG00000058793
AA Change: V47I

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 399 7.6e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110158
AA Change: V47I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105786
Gene: ENSMUSG00000058793
AA Change: V47I

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 129 3.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125060
Predicted Effect probably benign
Transcript: ENSMUST00000147456
Meta Mutation Damage Score 0.1544 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. Heterozygotes show a distorted lymphocyte distribution and enhanced sensorimotor gating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Acad10 A G 5: 121,631,543 S617P probably benign Het
Ahi1 A C 10: 21,074,427 M126L probably benign Het
Alk T C 17: 72,603,120 E197G probably damaging Het
Alyref2 A T 1: 171,503,979 Y108F probably damaging Het
Ankrd26 T G 6: 118,523,882 H876P probably damaging Het
Arfgef1 T C 1: 10,159,583 T1298A probably damaging Het
Arhgap33 T A 7: 30,519,620 probably benign Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
Arid1a A T 4: 133,681,739 V1819E unknown Het
Asprv1 A G 6: 86,628,550 N126S probably damaging Het
Atg16l2 T C 7: 101,300,211 Y43C probably damaging Het
Atp13a3 G T 16: 30,321,879 T1160K probably benign Het
Atp1a3 T C 7: 24,997,311 T272A probably damaging Het
Bpifa3 G T 2: 154,137,642 probably null Het
Bri3 T C 5: 144,255,906 V80A probably damaging Het
Ccdc28a T A 10: 18,230,572 E2V probably damaging Het
Ccdc7a T A 8: 128,980,096 probably benign Het
Cela2a G A 4: 141,825,988 probably benign Het
Ckap5 A G 2: 91,576,203 Y783C probably damaging Het
Cmtr1 G C 17: 29,663,243 A23P possibly damaging Het
Crym C A 7: 120,201,940 probably null Het
Def6 T G 17: 28,228,226 D610E probably benign Het
Dnajc15 T C 14: 77,826,458 Y130C probably damaging Het
Dock8 G A 19: 25,174,222 V1560I probably damaging Het
Eif4g3 T C 4: 138,190,692 V1501A probably damaging Het
Esyt1 A G 10: 128,511,510 S1049P probably damaging Het
Gm4952 G T 19: 12,626,911 R229L probably damaging Het
Gm5724 T C 6: 141,713,254 M539V probably benign Het
Golga5 T A 12: 102,489,448 H548Q probably benign Het
Gspt1 A T 16: 11,228,193 D449E possibly damaging Het
Gtf3c2 T A 5: 31,159,110 D732V probably damaging Het
Hax1 T A 3: 89,996,096 Q168L probably damaging Het
Hectd2 T A 19: 36,598,891 S91T possibly damaging Het
Igfbp2 T A 1: 72,852,144 H300Q probably benign Het
Il12rb2 T C 6: 67,292,213 N538S possibly damaging Het
Insr G A 8: 3,185,122 P124L possibly damaging Het
Irak3 C A 10: 120,145,689 R437L probably benign Het
Jhy C T 9: 40,897,438 V676I probably damaging Het
Kcns3 G A 12: 11,092,327 R124C probably benign Het
Lactb G A 9: 66,955,776 R519* probably null Het
Mdfic G A 6: 15,770,292 G94D probably damaging Het
Mospd3 A G 5: 137,600,351 V42A possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mucl1 T C 15: 103,755,397 I15V probably benign Het
Mug1 T A 6: 121,851,433 V268D possibly damaging Het
Myo5c T A 9: 75,272,903 S709T probably benign Het
Nol11 T A 11: 107,173,369 E519V probably benign Het
Nrp2 A T 1: 62,785,108 I791L probably benign Het
Nudt19 A G 7: 35,551,547 Y256H probably benign Het
Nudt8 C T 19: 4,000,777 R42C probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr806 T A 10: 129,738,816 I34F probably benign Het
Pcdhga12 A G 18: 37,767,369 Y418C probably damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Pdzd2 T C 15: 12,385,675 D1003G probably benign Het
Pglyrp4 T A 3: 90,740,274 probably null Het
Phip T C 9: 82,871,355 N1779D probably damaging Het
Postn G T 3: 54,372,106 C335F probably damaging Het
Ppp4r3a T C 12: 101,083,360 probably benign Het
Prrt2 C T 7: 127,019,418 V292M probably damaging Het
Rpl18 T C 7: 45,720,722 V138A possibly damaging Het
Rps14 G A 18: 60,777,133 probably benign Het
Sbno1 A G 5: 124,395,893 probably null Het
Siah2 T G 3: 58,676,400 K155T probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc25a39 T A 11: 102,403,394 probably benign Het
Smok2b T A 17: 13,236,344 C464S probably damaging Het
Spata31 G A 13: 64,922,041 V668I probably benign Het
Tbxas1 C A 6: 39,021,133 H212N probably benign Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Thada C T 17: 84,230,901 A1560T probably benign Het
Tmem241 G C 18: 12,064,206 F65L probably damaging Het
Ttc16 C G 2: 32,769,125 E321Q probably damaging Het
Ttn A T 2: 76,918,585 L4040H possibly damaging Het
Tyw1 G A 5: 130,282,022 W437* probably null Het
Unc79 T A 12: 103,001,943 Y143N probably damaging Het
Urb2 C T 8: 124,038,182 R1310W probably damaging Het
Vmn2r4 T C 3: 64,409,949 I34V probably benign Het
Zfp513 C T 5: 31,200,666 C121Y possibly damaging Het
Zfp606 T G 7: 12,493,529 W468G probably damaging Het
Zfyve16 C T 13: 92,504,471 probably null Het
Other mutations in Cds2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cds2 APN 2 132297293 missense probably damaging 1.00
IGL00434:Cds2 APN 2 132293351 missense probably damaging 0.99
IGL00771:Cds2 APN 2 132304352 splice site probably benign
IGL00984:Cds2 APN 2 132298521 missense probably benign 0.02
IGL02041:Cds2 APN 2 132294443 missense possibly damaging 0.94
sugarless UTSW 2 132298483 missense probably damaging 1.00
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0452:Cds2 UTSW 2 132298479 missense probably damaging 0.99
R0455:Cds2 UTSW 2 132285967 critical splice donor site probably null
R0593:Cds2 UTSW 2 132297376 unclassified probably benign
R0831:Cds2 UTSW 2 132285967 critical splice donor site probably null
R1053:Cds2 UTSW 2 132305260 missense probably damaging 1.00
R1669:Cds2 UTSW 2 132295519 splice site probably null
R1740:Cds2 UTSW 2 132302213 missense possibly damaging 0.63
R1859:Cds2 UTSW 2 132302195 missense probably damaging 1.00
R4125:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4126:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4128:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4352:Cds2 UTSW 2 132263445 start codon destroyed probably null 0.37
R4467:Cds2 UTSW 2 132294446 nonsense probably null
R4698:Cds2 UTSW 2 132304953 missense probably damaging 0.97
R4704:Cds2 UTSW 2 132300602 nonsense probably null
R4917:Cds2 UTSW 2 132298478 missense probably damaging 0.98
R5070:Cds2 UTSW 2 132302088 nonsense probably null
R5199:Cds2 UTSW 2 132298483 missense probably damaging 1.00
R5431:Cds2 UTSW 2 132302170 missense probably benign 0.28
R5858:Cds2 UTSW 2 132302113 missense probably benign 0.00
R5946:Cds2 UTSW 2 132297248 missense probably damaging 1.00
R5954:Cds2 UTSW 2 132297271 missense probably benign 0.00
R7195:Cds2 UTSW 2 132293284 missense probably benign 0.28
R7234:Cds2 UTSW 2 132304480 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGGGATCTCCTGTGACAAC -3'
(R):5'- CACAGCTGTTGTTAAGAGGACTG -3'

Sequencing Primer
(F):5'- ATGGGATCTCCTGTGACAACTGTTC -3'
(R):5'- CTTAGTTCTTCCTGGACTGAAGG -3'
Posted On2017-01-03