Incidental Mutation 'R5705:Ralgapa2'
ID451903
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene NameRal GTPase activating protein, alpha subunit 2 (catalytic)
SynonymsAS250, RGC2, A230067G21Rik
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location146239879-146512344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146449273 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 248 (Y248H)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109982
Predicted Effect probably damaging
Transcript: ENSMUST00000109986
AA Change: Y248H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: Y248H

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131824
AA Change: Y248H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: Y248H

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135974
Predicted Effect probably benign
Transcript: ENSMUST00000149499
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228797
AA Change: Y248H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146485136 missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146342522 missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146421739 missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146410193 missense probably benign 0.02
IGL01018:Ralgapa2 APN 2 146410192 missense probably benign 0.00
IGL01902:Ralgapa2 APN 2 146315014 missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146348440 splice site probably benign
IGL02321:Ralgapa2 APN 2 146412816 nonsense probably null
IGL02412:Ralgapa2 APN 2 146412132 missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146460775 splice site probably benign
IGL03115:Ralgapa2 APN 2 146424814 missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146460712 critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146357987 missense probably benign 0.01
P4748:Ralgapa2 UTSW 2 146346811 nonsense probably null
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0165:Ralgapa2 UTSW 2 146388487 splice site probably benign
R0344:Ralgapa2 UTSW 2 146346794 missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146434809 missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146428672 missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146342192 missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146451784 missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146388531 missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146436003 missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146450558 missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146357982 missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146388500 missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146388612 missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146358000 missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146342728 missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146387701 missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146460759 missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146388604 missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146431887 missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146342683 missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146353192 missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146361400 missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146421631 missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146485163 missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146435994 missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146342573 missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146260368 missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146353248 missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146435999 missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146315024 missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146361453 missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146387629 missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146345467 missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146345533 missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146346749 missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146405067 intron probably benign
R4962:Ralgapa2 UTSW 2 146434834 nonsense probably null
R4993:Ralgapa2 UTSW 2 146447311 missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146485151 missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146412084 missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146388486 splice site probably null
R5393:Ralgapa2 UTSW 2 146345455 missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146334494 missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146342510 missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146447436 missense probably benign
R5695:Ralgapa2 UTSW 2 146333477 missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146453406 splice site probably null
R5817:Ralgapa2 UTSW 2 146333486 missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146388569 missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146361453 missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146434845 missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146424676 missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146450465 missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146342209 missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146327411 missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146388502 missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146342701 missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146346718 nonsense probably null
R7035:Ralgapa2 UTSW 2 146511857 missense probably damaging 1.00
R7167:Ralgapa2 UTSW 2 146348454 missense probably benign
R7186:Ralgapa2 UTSW 2 146388486 splice site probably null
R7252:Ralgapa2 UTSW 2 146342751 critical splice acceptor site probably null
R7266:Ralgapa2 UTSW 2 146334568 missense probably damaging 1.00
R7371:Ralgapa2 UTSW 2 146347126 missense probably benign 0.05
R7432:Ralgapa2 UTSW 2 146434856 missense probably benign 0.41
R7470:Ralgapa2 UTSW 2 146424667 missense probably damaging 1.00
X0019:Ralgapa2 UTSW 2 146388652 missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146434905 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGTAACTTTAACTTCTCATAACAGCAT -3'
(R):5'- TGAGCTTTGTTGAGATACAGTTTC -3'

Sequencing Primer
(F):5'- ACTTCTCATAACAGCATTACCATTC -3'
(R):5'- GCTTTGTTGAGATACAGTTTCTTTAC -3'
Posted On2017-01-03