Incidental Mutation 'R5705:Trim30b'
ID451922
Institutional Source Beutler Lab
Gene Symbol Trim30b
Ensembl Gene ENSMUSG00000052749
Gene Nametripartite motif-containing 30B
SynonymsTrim30-1, A530023O14Rik
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104355382-104369884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104357577 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 24 (Y24F)
Ref Sequence ENSEMBL: ENSMUSP00000131288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000106831] [ENSMUST00000130139] [ENSMUST00000164410] [ENSMUST00000171830]
Predicted Effect probably benign
Transcript: ENSMUST00000059037
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106831
SMART Domains Protein: ENSMUSP00000102444
Gene: ENSMUSG00000052749

DomainStartEndE-ValueType
RING 15 59 4.37e-10 SMART
BBOX 92 133 2.82e-13 SMART
coiled coil region 138 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130139
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155961
Predicted Effect probably benign
Transcript: ENSMUST00000164410
SMART Domains Protein: ENSMUSP00000131747
Gene: ENSMUSG00000052749

DomainStartEndE-ValueType
RING 15 59 4.37e-10 SMART
BBOX 92 133 2.82e-13 SMART
coiled coil region 138 171 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171830
AA Change: Y24F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131288
Gene: ENSMUSG00000052749
AA Change: Y24F

DomainStartEndE-ValueType
PDB:3UV9|A 1 132 5e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209729
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Trim30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Trim30b APN 7 104366051 nonsense probably null
IGL02262:Trim30b APN 7 104365900 missense probably damaging 0.99
IGL03297:Trim30b APN 7 104365895 missense probably benign 0.40
R0078:Trim30b UTSW 7 104365895 missense probably benign 0.40
R0416:Trim30b UTSW 7 104363766 missense probably benign 0.08
R0511:Trim30b UTSW 7 104365803 missense possibly damaging 0.91
R0555:Trim30b UTSW 7 104357298 missense possibly damaging 0.73
R0609:Trim30b UTSW 7 104357976 start gained probably benign
R1317:Trim30b UTSW 7 104357335 missense possibly damaging 0.90
R1318:Trim30b UTSW 7 104357335 missense possibly damaging 0.90
R1528:Trim30b UTSW 7 104357299 missense possibly damaging 0.73
R1603:Trim30b UTSW 7 104365812 missense possibly damaging 0.70
R3859:Trim30b UTSW 7 104357280 missense probably benign 0.00
R4052:Trim30b UTSW 7 104357478 missense possibly damaging 0.64
R4576:Trim30b UTSW 7 104357331 missense possibly damaging 0.75
R4577:Trim30b UTSW 7 104357331 missense possibly damaging 0.75
R4578:Trim30b UTSW 7 104357331 missense possibly damaging 0.75
R5753:Trim30b UTSW 7 104357337 missense possibly damaging 0.89
R5846:Trim30b UTSW 7 104357371 missense possibly damaging 0.94
R5914:Trim30b UTSW 7 104357365 missense probably damaging 0.98
R6083:Trim30b UTSW 7 104366142 missense probably damaging 0.98
R6862:Trim30b UTSW 7 104363753 missense probably damaging 0.98
R7216:Trim30b UTSW 7 104357362 missense probably benign 0.22
Z1088:Trim30b UTSW 7 104366100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACAGGACACTTATCAAAGGC -3'
(R):5'- ACTCTGCACAGCAATCTGCC -3'

Sequencing Primer
(F):5'- GGACACTTATCAAAGGCATATACAG -3'
(R):5'- GCCTCTGCTTGATTTAAACACGG -3'
Posted On2017-01-03