Incidental Mutation 'R5705:Pcmt1'
ID451929
Institutional Source Beutler Lab
Gene Symbol Pcmt1
Ensembl Gene ENSMUSG00000019795
Gene Nameprotein-L-isoaspartate (D-aspartate) O-methyltransferase 1
SynonymsPIMT, protein carboxyl methyltransferase
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location7629373-7681136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7638190 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 224 (I224M)
Ref Sequence ENSEMBL: ENSMUSP00000125144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159917] [ENSMUST00000161123] [ENSMUST00000162606] [ENSMUST00000163085]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159917
AA Change: I238M

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124932
Gene: ENSMUSG00000019795
AA Change: I238M

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 1.1e-88 PFAM
Pfam:Ubie_methyltran 126 258 3.4e-7 PFAM
Pfam:Methyltransf_31 134 284 1.1e-8 PFAM
Pfam:Methyltransf_18 136 241 3e-9 PFAM
Pfam:Methyltransf_11 141 239 1.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160250
Predicted Effect probably benign
Transcript: ENSMUST00000161123
SMART Domains Protein: ENSMUSP00000124100
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 53 108 4.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161428
SMART Domains Protein: ENSMUSP00000123758
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 160 2.7e-61 PFAM
Pfam:Ubie_methyltran 49 148 8.3e-7 PFAM
Pfam:Methyltransf_31 58 111 3.9e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162606
AA Change: I238M

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123866
Gene: ENSMUSG00000019795
AA Change: I238M

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 2e-88 PFAM
Pfam:Ubie_methyltran 126 259 1e-6 PFAM
Pfam:Methyltransf_31 134 283 3.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163085
AA Change: I224M

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125144
Gene: ENSMUSG00000019795
AA Change: I224M

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 52 265 9.1e-89 PFAM
Pfam:Ubie_methyltran 112 244 3.1e-7 PFAM
Pfam:Methyltransf_31 120 270 9.8e-9 PFAM
Pfam:Methyltransf_18 122 227 2.7e-9 PFAM
Pfam:Methyltransf_11 127 225 1.4e-6 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene causes accumulation of modified proteins, growth retardation and fatal epileptic seizures. Homozygotes for one null allele also show a small spleen, altered lipid, hormone, mineral and enzyme profiles, kyphosis, enlarged brain and abnormal dendritic arborizations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Pcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02934:Pcmt1 APN 10 7640727 missense probably benign 0.00
R1968:Pcmt1 UTSW 10 7640710 nonsense probably null
R3889:Pcmt1 UTSW 10 7649050 critical splice donor site probably null
R5454:Pcmt1 UTSW 10 7640745 missense probably damaging 1.00
R5630:Pcmt1 UTSW 10 7649093 missense probably damaging 1.00
R6667:Pcmt1 UTSW 10 7663149 missense probably damaging 1.00
R7163:Pcmt1 UTSW 10 7638158 missense probably benign 0.01
R7168:Pcmt1 UTSW 10 7638182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGCTAAGGTCTTAAAGCCC -3'
(R):5'- AAATGAACCCCTGAGGACGC -3'

Sequencing Primer
(F):5'- CCTTTCACCTTGACTGTGTGGAG -3'
(R):5'- CCTGAGGACGCTAAGATGTTC -3'
Posted On2017-01-03