Incidental Mutation 'R5705:Kcnma1'
ID451943
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Namepotassium large conductance calcium-activated channel, subfamily M, alpha member 1
SynonymsmSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location23289431-24014491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24003771 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 54 (C54S)
Ref Sequence ENSEMBL: ENSMUSP00000140154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145596] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190339] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000223749] [ENSMUST00000224077] [ENSMUST00000224232] [ENSMUST00000224285] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000224812] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225471] [ENSMUST00000225556] [ENSMUST00000225794] [ENSMUST00000226051]
Predicted Effect probably benign
Transcript: ENSMUST00000145596
AA Change: C119S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000188210
AA Change: C54S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: C54S

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188285
AA Change: C119S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142
AA Change: C119S

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188991
AA Change: C119S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142
AA Change: C119S

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190044
AA Change: C119S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142
AA Change: C119S

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190339
AA Change: C119S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141143
Gene: ENSMUSG00000063142
AA Change: C119S

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190985
AA Change: C54S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223609
Predicted Effect probably benign
Transcript: ENSMUST00000223655
AA Change: C54S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000223727
AA Change: C54S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000223749
AA Change: C54S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223837
Predicted Effect probably benign
Transcript: ENSMUST00000224025
AA Change: C69S

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000224077
AA Change: C54S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224232
AA Change: C54S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000224285
AA Change: C54S

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000224468
AA Change: C119S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000224787
AA Change: C54S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000224812
AA Change: C54S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000225315
AA Change: C54S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000225431
AA Change: C54S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000225471
AA Change: C54S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000225556
AA Change: C54S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000225794
AA Change: C54S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000226051
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23314322 splice site probably benign
IGL01520:Kcnma1 APN 14 23501143 missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23530299 splice site probably benign
IGL02140:Kcnma1 APN 14 23309045 missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23336967 missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23526813 missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23543076 missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23311689 missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23386259 critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23363832 missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23463156 missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23309154 missense probably damaging 1.00
PIT4495001:Kcnma1 UTSW 14 23425597 missense probably benign 0.00
PIT4514001:Kcnma1 UTSW 14 23309035 splice site probably null
PIT4576001:Kcnma1 UTSW 14 23309035 splice site probably null
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0115:Kcnma1 UTSW 14 23314175 missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23803166 missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23508052 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23373197 missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23311716 missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23509784 splice site probably benign
R0668:Kcnma1 UTSW 14 23367495 missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23494607 missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23367642 missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23311724 missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23463200 missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23314194 missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1828:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1864:Kcnma1 UTSW 14 23803162 missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23337029 missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23314220 missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23543083 nonsense probably null
R2866:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23299938 missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23505255 missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23311652 missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23337029 missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23309038 critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23803202 missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23363836 missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23309152 missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24004118 intron probably benign
R5175:Kcnma1 UTSW 14 23336038 critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23463185 missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23528404 nonsense probably null
R5746:Kcnma1 UTSW 14 23494567 missense probably damaging 1.00
R5780:Kcnma1 UTSW 14 23386351 nonsense probably null
R5793:Kcnma1 UTSW 14 23309035 splice site probably null
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24003868 missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23509889 missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23336097 missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24002814 nonsense probably null
R6822:Kcnma1 UTSW 14 24003744 splice site probably null
R6855:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23526534 critical splice donor site probably null
R7017:Kcnma1 UTSW 14 23494643 missense possibly damaging 0.79
R7081:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R7113:Kcnma1 UTSW 14 23463156 missense probably damaging 1.00
R7131:Kcnma1 UTSW 14 23367494 missense probably damaging 1.00
R7172:Kcnma1 UTSW 14 23526623 missense probably damaging 1.00
R7207:Kcnma1 UTSW 14 23309015 makesense probably null
R7308:Kcnma1 UTSW 14 23330935 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCGGCCATAGTCACCAATAG -3'
(R):5'- GAACCATCTCAGCCTAGACG -3'

Sequencing Primer
(F):5'- TGCTGGGGTCAACTCCTCAC -3'
(R):5'- ATCTCAGCCTAGACGCGTCC -3'
Posted On2017-01-03