Incidental Mutation 'R5705:Ppp1r10'
ID451948
Institutional Source Beutler Lab
Gene Symbol Ppp1r10
Ensembl Gene ENSMUSG00000039220
Gene Nameprotein phosphatase 1, regulatory subunit 10
SynonymsPNUTS, D17Ertd808e, 2610025H06Rik
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35916434-35932283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35929489 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 557 (V557A)
Ref Sequence ENSEMBL: ENSMUSP00000084461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087210] [ENSMUST00000087211]
Predicted Effect probably damaging
Transcript: ENSMUST00000087210
AA Change: V557A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084460
Gene: ENSMUSG00000039220
AA Change: V557A

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087211
AA Change: V557A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084461
Gene: ENSMUSG00000039220
AA Change: V557A

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151375
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase 1 binding protein. The encoded protein plays a role in many cellular processes including cell cycle progression, DNA repair and apoptosis by regulating the activity of protein phosphatase 1. This gene lies within the major histocompatibility complex class I region on chromosome 6, and alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Ppp1r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp1r10 APN 17 35924859 missense probably damaging 0.99
IGL01113:Ppp1r10 APN 17 35929559 missense probably damaging 0.98
IGL01144:Ppp1r10 APN 17 35926564 missense probably benign 0.28
IGL01650:Ppp1r10 APN 17 35931161 missense unknown
IGL02445:Ppp1r10 APN 17 35926202 missense probably damaging 1.00
IGL02715:Ppp1r10 APN 17 35930712 missense unknown
IGL02797:Ppp1r10 APN 17 35928012 critical splice donor site probably null
IGL03181:Ppp1r10 APN 17 35930624 nonsense probably null
R1183:Ppp1r10 UTSW 17 35929443 missense possibly damaging 0.56
R1710:Ppp1r10 UTSW 17 35926536 missense probably damaging 0.96
R2166:Ppp1r10 UTSW 17 35930589 missense unknown
R2865:Ppp1r10 UTSW 17 35928492 missense possibly damaging 0.86
R2898:Ppp1r10 UTSW 17 35928892 missense probably damaging 1.00
R3692:Ppp1r10 UTSW 17 35930868 missense unknown
R4612:Ppp1r10 UTSW 17 35927931 missense probably damaging 1.00
R4716:Ppp1r10 UTSW 17 35929460 missense probably benign 0.16
R4796:Ppp1r10 UTSW 17 35924087 missense probably damaging 1.00
R4997:Ppp1r10 UTSW 17 35924084 missense probably damaging 1.00
R5152:Ppp1r10 UTSW 17 35929252 missense probably damaging 1.00
R5186:Ppp1r10 UTSW 17 35928511 missense probably damaging 1.00
R5364:Ppp1r10 UTSW 17 35930432 missense unknown
R5847:Ppp1r10 UTSW 17 35926847 missense possibly damaging 0.85
R6912:Ppp1r10 UTSW 17 35929561 missense possibly damaging 0.70
R6974:Ppp1r10 UTSW 17 35929551 missense probably benign 0.03
R7169:Ppp1r10 UTSW 17 35929473 missense probably damaging 1.00
R7302:Ppp1r10 UTSW 17 35930881 missense unknown
R7403:Ppp1r10 UTSW 17 35929434 missense probably benign 0.05
R7427:Ppp1r10 UTSW 17 35930133 missense possibly damaging 0.53
Z1088:Ppp1r10 UTSW 17 35930767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GATGAGGTAAGTGGCTGTCAC -3'
(R):5'- AACTGGGATAAGCCAGGCAC -3'

Sequencing Primer
(F):5'- CACTGTTGTGGGTGGGAAGC -3'
(R):5'- ACAGGGTGCAGGATGTCC -3'
Posted On2017-01-03