Incidental Mutation 'R5706:Gm4778'
ID451961
Institutional Source Beutler Lab
Gene Symbol Gm4778
Ensembl Gene ENSMUSG00000089696
Gene Namepredicted gene 4778
Synonyms
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location94264036-94266784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94266652 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 322 (H322Q)
Ref Sequence ENSEMBL: ENSMUSP00000096477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098878] [ENSMUST00000159517]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098878
AA Change: H322Q

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096477
Gene: ENSMUSG00000089696
AA Change: H322Q

DomainStartEndE-ValueType
MATH 25 134 6.01e-8 SMART
BTB 192 291 7.66e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159517
AA Change: H318Q

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123868
Gene: ENSMUSG00000089696
AA Change: H318Q

DomainStartEndE-ValueType
MATH 21 130 6.01e-8 SMART
BTB 188 287 7.66e-26 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Gm4778
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Gm4778 APN 3 94266484 missense probably benign 0.00
IGL02032:Gm4778 APN 3 94266333 missense probably damaging 1.00
IGL02694:Gm4778 APN 3 94266152 missense probably benign
IGL03171:Gm4778 APN 3 94266455 missense probably benign 0.00
R0195:Gm4778 UTSW 3 94265922 missense possibly damaging 0.79
R0739:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1064:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1150:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1152:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1284:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1286:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1287:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1349:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1358:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1372:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1383:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1399:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1756:Gm4778 UTSW 3 94266218 missense probably benign
R1996:Gm4778 UTSW 3 94265711 missense probably benign 0.00
R2679:Gm4778 UTSW 3 94265910 missense probably damaging 1.00
R2878:Gm4778 UTSW 3 94266480 missense possibly damaging 0.69
R5108:Gm4778 UTSW 3 94265835 missense probably damaging 1.00
R6251:Gm4778 UTSW 3 94265901 missense probably damaging 1.00
R6928:Gm4778 UTSW 3 94266548 missense probably benign 0.31
R7091:Gm4778 UTSW 3 94266638 missense probably damaging 1.00
R7264:Gm4778 UTSW 3 94265738 missense possibly damaging 0.86
R7503:Gm4778 UTSW 3 94266473 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GATGGGCTTCATTTACACTGGG -3'
(R):5'- GTTGGAAGACAGATGTTGGTCATAG -3'

Sequencing Primer
(F):5'- GCTTCATTTACACTGGGAAGGCAC -3'
(R):5'- CAGATGTTGGTCATAGATTTCCATCC -3'
Posted On2017-01-03