Incidental Mutation 'R5707:Nhsl1'
ID452029
Institutional Source Beutler Lab
Gene Symbol Nhsl1
Ensembl Gene ENSMUSG00000039835
Gene NameNHS-like 1
Synonyms5730409E15Rik, D10Bwg0940e, A630035H13Rik
MMRRC Submission 043332-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5707 (G1)
Quality Score183
Status Validated
Chromosome10
Chromosomal Location18318985-18533892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18526503 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1159 (T1159M)
Ref Sequence ENSEMBL: ENSMUSP00000147021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037341] [ENSMUST00000100054] [ENSMUST00000162891] [ENSMUST00000207038]
Predicted Effect probably damaging
Transcript: ENSMUST00000037341
AA Change: T1129M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040799
Gene: ENSMUSG00000039835
AA Change: T1129M

DomainStartEndE-ValueType
Pfam:NHS 258 906 1.6e-246 PFAM
low complexity region 918 938 N/A INTRINSIC
low complexity region 942 950 N/A INTRINSIC
low complexity region 958 970 N/A INTRINSIC
low complexity region 992 1024 N/A INTRINSIC
low complexity region 1171 1197 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
low complexity region 1442 1460 N/A INTRINSIC
low complexity region 1484 1503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100054
AA Change: T1125M

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097631
Gene: ENSMUSG00000039835
AA Change: T1125M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 7.3e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
low complexity region 938 946 N/A INTRINSIC
low complexity region 954 966 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
low complexity region 1167 1193 N/A INTRINSIC
low complexity region 1369 1381 N/A INTRINSIC
low complexity region 1438 1456 N/A INTRINSIC
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159299
SMART Domains Protein: ENSMUSP00000124629
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162891
SMART Domains Protein: ENSMUSP00000124072
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 2.1e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207038
AA Change: T1159M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,173,312 N93S probably benign Het
9330182L06Rik A G 5: 9,441,698 Y686C probably damaging Het
Abca13 T C 11: 9,510,620 L4210P probably damaging Het
Adcy6 T C 15: 98,598,741 T518A probably damaging Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aqp11 A G 7: 97,737,428 V187A possibly damaging Het
Arhgef15 A G 11: 68,954,715 S104P probably damaging Het
BC027072 G T 17: 71,751,572 A370E possibly damaging Het
Birc6 T A 17: 74,696,404 N4762K probably damaging Het
Cacna1e T C 1: 154,633,717 D264G probably damaging Het
Cela3b G T 4: 137,424,856 Q97K probably damaging Het
Cenpc1 T A 5: 86,035,434 R499W possibly damaging Het
Cnr1 C A 4: 33,944,330 C239* probably null Het
Col6a2 T C 10: 76,611,031 K348E possibly damaging Het
Ctnnb1 C A 9: 120,955,168 L368I probably benign Het
Diras1 T C 10: 81,022,081 E112G probably benign Het
Dopey1 T A 9: 86,502,997 M332K possibly damaging Het
Dpy19l1 T C 9: 24,414,267 *747W probably null Het
Dydc2 T G 14: 41,061,954 T71P probably damaging Het
Ggt1 T A 10: 75,585,238 I429N probably benign Het
Gm5114 G C 7: 39,411,276 L50V probably benign Het
Gm5121 T G 9: 57,334,483 noncoding transcript Het
Kidins220 A G 12: 25,013,391 D933G probably damaging Het
Kirrel3 A G 9: 35,013,276 K286R probably damaging Het
Klf5 T C 14: 99,301,508 I39T probably benign Het
Krt14 C T 11: 100,204,758 V274I possibly damaging Het
Meiob A G 17: 24,835,051 D364G probably benign Het
Mroh7 T A 4: 106,681,885 E1190D possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1360 A G 13: 21,674,599 L115P probably damaging Het
Olfr366 C A 2: 37,219,889 N133K probably benign Het
Olfr382 G T 11: 73,516,625 D191E probably damaging Het
Pdlim5 T A 3: 142,304,299 H294L probably damaging Het
Pdzd8 A T 19: 59,299,625 D1114E probably benign Het
Phf20 T G 2: 156,296,771 probably null Het
Plec C T 15: 76,199,671 probably benign Het
Ppp1r18 T C 17: 35,867,236 M1T probably null Het
Ppp4r3a G A 12: 101,058,511 T243I probably damaging Het
Prss41 C T 17: 23,842,416 V134I probably benign Het
Pter T C 2: 12,978,180 probably benign Het
Rasgef1b T G 5: 99,234,602 K176N possibly damaging Het
Reps1 T A 10: 18,056,010 D16E probably benign Het
Slc4a5 T A 6: 83,261,415 D73E probably benign Het
Smgc A T 15: 91,860,663 T146S possibly damaging Het
Sptbn1 A T 11: 30,143,174 W396R possibly damaging Het
Stkld1 A G 2: 26,943,987 E162G probably damaging Het
Tanc1 T C 2: 59,758,530 F106L probably benign Het
Tarbp1 A G 8: 126,467,144 Y340H probably damaging Het
Tenm2 T C 11: 36,047,182 I1556V possibly damaging Het
Tmem64 T C 4: 15,266,288 C113R probably damaging Het
Try4 T C 6: 41,305,043 F188L possibly damaging Het
Ttc25 G A 11: 100,554,061 A348T probably damaging Het
Ucn3 A G 13: 3,941,556 V32A probably benign Het
Vmn2r83 T A 10: 79,491,349 M597K possibly damaging Het
Wdr90 A G 17: 25,857,192 V491A probably benign Het
Xylt1 T A 7: 117,656,494 M763K possibly damaging Het
Zfp507 G T 7: 35,794,163 A485E probably damaging Het
Other mutations in Nhsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Nhsl1 APN 10 18527609 missense probably benign 0.07
IGL01121:Nhsl1 APN 10 18511710 missense probably damaging 1.00
IGL01775:Nhsl1 APN 10 18524474 missense probably damaging 0.99
IGL02143:Nhsl1 APN 10 18511635 missense possibly damaging 0.74
IGL02606:Nhsl1 APN 10 18511637 missense probably damaging 1.00
IGL02642:Nhsl1 APN 10 18408390 missense possibly damaging 0.96
IGL02866:Nhsl1 APN 10 18527607 missense probably damaging 0.99
IGL03263:Nhsl1 APN 10 18498079 nonsense probably null
IGL03380:Nhsl1 APN 10 18523879 nonsense probably null
PIT4651001:Nhsl1 UTSW 10 18408435 missense probably damaging 0.98
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0116:Nhsl1 UTSW 10 18525242 nonsense probably null
R0245:Nhsl1 UTSW 10 18525108 missense probably damaging 1.00
R0254:Nhsl1 UTSW 10 18472985 missense probably damaging 1.00
R0288:Nhsl1 UTSW 10 18524046 missense probably damaging 1.00
R0648:Nhsl1 UTSW 10 18531726 missense possibly damaging 0.92
R1055:Nhsl1 UTSW 10 18525475 missense probably benign 0.08
R1300:Nhsl1 UTSW 10 18408461 missense probably benign
R1384:Nhsl1 UTSW 10 18408513 missense probably null 0.96
R1453:Nhsl1 UTSW 10 18531575 missense probably damaging 1.00
R1523:Nhsl1 UTSW 10 18408355 missense probably benign
R1595:Nhsl1 UTSW 10 18526348 missense probably damaging 0.98
R1786:Nhsl1 UTSW 10 18524664 missense probably benign 0.28
R1836:Nhsl1 UTSW 10 18524905 missense possibly damaging 0.87
R1878:Nhsl1 UTSW 10 18524279 missense probably damaging 1.00
R2013:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2014:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2015:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R3115:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3116:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3754:Nhsl1 UTSW 10 18516034 missense probably damaging 0.99
R4342:Nhsl1 UTSW 10 18526689 missense probably damaging 1.00
R4595:Nhsl1 UTSW 10 18527609 missense probably benign 0.07
R4604:Nhsl1 UTSW 10 18531410 missense probably damaging 0.99
R4666:Nhsl1 UTSW 10 18531405 missense probably damaging 1.00
R5223:Nhsl1 UTSW 10 18526326 missense probably damaging 1.00
R5258:Nhsl1 UTSW 10 18524322 nonsense probably null
R5796:Nhsl1 UTSW 10 18524250 missense probably benign 0.06
R5960:Nhsl1 UTSW 10 18526976 missense probably benign
R6190:Nhsl1 UTSW 10 18470041 intron probably benign
R6272:Nhsl1 UTSW 10 18524505 missense probably benign 0.01
R6677:Nhsl1 UTSW 10 18525862 missense probably damaging 0.98
R6714:Nhsl1 UTSW 10 18524711 missense possibly damaging 0.74
R6765:Nhsl1 UTSW 10 18531314 missense probably benign 0.01
R6892:Nhsl1 UTSW 10 18524343 missense probably damaging 1.00
R7049:Nhsl1 UTSW 10 18531638 missense probably damaging 0.99
R7060:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R7236:Nhsl1 UTSW 10 18525764 missense probably damaging 1.00
R7305:Nhsl1 UTSW 10 18531686 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATCACCACAGAAGCTTTGCAG -3'
(R):5'- TACCACCAGGAACAGTTTGGG -3'

Sequencing Primer
(F):5'- CCACAGAAGCTTTGCAGATGGTG -3'
(R):5'- ACCAGGAACAGTTTGGGCTTCTTAG -3'
Posted On2017-01-03