Incidental Mutation 'R0551:Ganab'
ID45206
Institutional Source Beutler Lab
Gene Symbol Ganab
Ensembl Gene ENSMUSG00000071650
Gene Namealpha glucosidase 2 alpha neutral subunit
SynonymsG2an, GluII
MMRRC Submission 038743-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R0551 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8898090-8916663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 8907280 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 149 (I149S)
Ref Sequence ENSEMBL: ENSMUSP00000093965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246]
Predicted Effect probably benign
Transcript: ENSMUST00000096246
AA Change: I149S

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: I149S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Auts2 T C 5: 131,440,469 E446G possibly damaging Het
Brwd1 C T 16: 96,035,974 R886H probably damaging Het
Carm1 G A 9: 21,580,491 probably null Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Clca4b T A 3: 144,928,626 T69S probably damaging Het
Cpox A G 16: 58,675,390 I357V probably benign Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Klkb1 A G 8: 45,277,966 probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Manba T C 3: 135,517,973 I207T probably damaging Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd4a G A 1: 132,041,919 T348I probably damaging Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tiam2 T A 17: 3,428,954 M654K probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Ganab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ganab APN 19 8902595 missense probably benign
IGL00434:Ganab APN 19 8907343 missense probably damaging 1.00
IGL01415:Ganab APN 19 8914694 splice site probably benign
IGL02418:Ganab APN 19 8911069 missense probably null 0.97
IGL02886:Ganab APN 19 8911027 splice site probably benign
IGL02997:Ganab APN 19 8915412 missense probably benign 0.00
IGL03108:Ganab APN 19 8912476 missense probably damaging 1.00
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0349:Ganab UTSW 19 8911652 missense probably null 0.11
R0457:Ganab UTSW 19 8907250 missense possibly damaging 0.92
R0645:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0652:Ganab UTSW 19 8915402 critical splice acceptor site probably null
R0688:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0726:Ganab UTSW 19 8911113 missense probably damaging 1.00
R1427:Ganab UTSW 19 8915666 missense probably benign 0.00
R1946:Ganab UTSW 19 8910808 missense probably damaging 1.00
R1955:Ganab UTSW 19 8911616 nonsense probably null
R2173:Ganab UTSW 19 8902260 unclassified probably benign
R2280:Ganab UTSW 19 8909468 missense probably damaging 1.00
R2281:Ganab UTSW 19 8909468 missense probably damaging 1.00
R4897:Ganab UTSW 19 8914991 missense probably benign 0.07
R5224:Ganab UTSW 19 8910591 missense probably benign 0.35
R5269:Ganab UTSW 19 8911937 missense probably damaging 1.00
R5323:Ganab UTSW 19 8908685 missense probably benign 0.00
R5850:Ganab UTSW 19 8911707 missense probably damaging 1.00
R6469:Ganab UTSW 19 8902632 critical splice donor site probably null
R6911:Ganab UTSW 19 8907788 intron probably null
Predicted Primers PCR Primer
(F):5'- CTTCTGCTGAACCCAAGGACCTAAG -3'
(R):5'- AGTAAGTTCCCTGAAGTCCCCACC -3'

Sequencing Primer
(F):5'- agaggttagaggataatttgggg -3'
(R):5'- ACCCTGTACTCACGGGAC -3'
Posted On2013-06-11