Incidental Mutation 'R5708:Tnik'
ID452065
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission 043333-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5708 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 28611971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect probably null
Transcript: ENSMUST00000159236
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159308
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159680
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160307
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160518
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161964
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect probably null
Transcript: ENSMUST00000162485
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162777
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,707 M158L probably benign Het
1700067K01Rik A G 8: 84,002,998 K101R probably benign Het
4933430I17Rik T C 4: 62,525,869 S18P probably benign Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aox4 G T 1: 58,245,873 A595S possibly damaging Het
Asxl2 T A 12: 3,500,603 S782T possibly damaging Het
C1s2 A T 6: 124,625,743 L503* probably null Het
C7 A G 15: 5,015,401 V385A possibly damaging Het
Cdh20 T C 1: 104,984,910 F630L probably damaging Het
Cdk14 A C 5: 5,266,036 probably benign Het
Cdkl4 T C 17: 80,539,522 I239M possibly damaging Het
Col11a1 A G 3: 114,097,094 N360S unknown Het
D630003M21Rik A G 2: 158,220,392 probably null Het
Dchs1 G A 7: 105,772,809 P135S probably damaging Het
Dpysl2 A G 14: 66,813,146 S421P probably benign Het
Edn1 A T 13: 42,303,667 M59L probably benign Het
EU599041 A G 7: 43,225,887 noncoding transcript Het
Fam196a C A 7: 134,918,796 V2F probably damaging Het
Furin A G 7: 80,397,855 probably benign Het
Gkn2 T C 6: 87,377,436 L94P probably damaging Het
Gmeb2 A T 2: 181,264,989 C117S probably damaging Het
Greb1 T A 12: 16,673,842 I1869F probably benign Het
Heg1 A G 16: 33,742,404 E1119G probably damaging Het
Hmgcs2 T A 3: 98,291,162 L127Q probably damaging Het
Kcnh6 A G 11: 106,020,256 R493G probably benign Het
Kcnj11 C T 7: 46,099,818 R27H probably benign Het
Klra14-ps A G 6: 130,157,788 noncoding transcript Het
Lgmn A T 12: 102,404,328 N114K possibly damaging Het
Lipg C T 18: 74,955,434 M148I possibly damaging Het
Megf8 G T 7: 25,334,597 R607L probably benign Het
Mks1 A G 11: 87,856,839 T183A probably benign Het
Mllt11 A G 3: 95,220,204 V85A probably benign Het
Mpo A T 11: 87,801,755 probably null Het
Muc4 A T 16: 32,754,769 probably benign Het
Myoz3 T C 18: 60,579,032 Y158C probably damaging Het
Olfr1287 A G 2: 111,450,009 R290G probably damaging Het
Olfr290 A G 7: 84,916,183 I135V possibly damaging Het
Olfr741 A T 14: 50,485,995 D179V probably damaging Het
Polq T A 16: 37,061,018 S902R probably damaging Het
Rarb T C 14: 16,548,545 T93A probably damaging Het
Rgs12 A G 5: 34,966,352 D493G probably benign Het
Sec31b T A 19: 44,523,144 D606V probably damaging Het
Setd2 T C 9: 110,548,823 F569L possibly damaging Het
Sil1 T C 18: 35,341,117 E149G probably benign Het
Spata13 T G 14: 60,692,003 S337A probably damaging Het
Srfbp1 T A 18: 52,488,946 L360M probably damaging Het
Tecta A T 9: 42,338,926 C1852S probably damaging Het
Tgfbr3l A G 8: 4,250,360 T208A probably damaging Het
Tmem38b G C 4: 53,849,051 probably null Het
Tnfrsf11a T A 1: 105,813,820 probably null Het
Tsc1 A T 2: 28,665,185 probably benign Het
Zfp930 T C 8: 69,226,461 V41A probably benign Het
Zscan18 A T 7: 12,774,456 D372E probably benign Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTCATGGACGAGGCACTG -3'
(R):5'- CGCAACTGTGTCTGTGTTTC -3'

Sequencing Primer
(F):5'- GAGGCACTGTCTGTAACTTGTAACC -3'
(R):5'- TGTGTTTCCAAGTTTTTACCCAG -3'
Posted On2017-01-03